ID: 1088819407

View in Genome Browser
Species Human (GRCh38)
Location 11:113444646-113444668
Sequence TAAATGGTGGCTGATGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088819404_1088819407 -9 Left 1088819404 11:113444632-113444654 CCATGGGCCATCTATAAATGGTG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1088819407 11:113444646-113444668 TAAATGGTGGCTGATGATGACGG 0: 1
1: 0
2: 3
3: 22
4: 232
1088819399_1088819407 20 Left 1088819399 11:113444603-113444625 CCACAACCTGAATGACTGTCTTT 0: 1
1: 0
2: 1
3: 10
4: 191
Right 1088819407 11:113444646-113444668 TAAATGGTGGCTGATGATGACGG 0: 1
1: 0
2: 3
3: 22
4: 232
1088819400_1088819407 14 Left 1088819400 11:113444609-113444631 CCTGAATGACTGTCTTTTACACT 0: 1
1: 0
2: 0
3: 19
4: 181
Right 1088819407 11:113444646-113444668 TAAATGGTGGCTGATGATGACGG 0: 1
1: 0
2: 3
3: 22
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088819407 Original CRISPR TAAATGGTGGCTGATGATGA CGG Intronic
900894586 1:5474339-5474361 AAAACTGTGGCTGGTGATGATGG + Intergenic
901127132 1:6937553-6937575 TAAGTGGTGAATGGTGATGATGG - Intronic
901681021 1:10912906-10912928 AAAATGTTGGATGAGGATGAAGG - Intergenic
901784505 1:11615900-11615922 TAAAATATGGATGATGATGATGG - Intergenic
901894901 1:12303075-12303097 AAAATGATGGCTGGTGAAGAAGG - Intronic
903144969 1:21365722-21365744 TAAATGCTGGCTGGGGATGGTGG + Intergenic
904509692 1:30993638-30993660 TAAATGGGGGCTGGTGGTGGTGG - Intronic
905888546 1:41505070-41505092 TAAATGGTGGCTGTGGATGGTGG - Intergenic
906243849 1:44259403-44259425 TGAAATGTGGCTGATGAGGAAGG + Intronic
908918905 1:69166811-69166833 TAAATGCTGGGTGATGGTCATGG - Intergenic
909664212 1:78115736-78115758 TAAATGGTGGCTGATGATTTGGG - Intronic
912493050 1:110072659-110072681 TTAATAGATGCTGATGATGATGG + Intronic
912678920 1:111715658-111715680 TAAATGGTGGCCATTTATGATGG - Exonic
915129773 1:153688253-153688275 TAAATGGTGGCTGTGGAGGAAGG - Intronic
916188588 1:162157166-162157188 TAAGGGCTGGCAGATGATGAGGG - Intronic
916436179 1:164780041-164780063 TAAATGCTTTTTGATGATGATGG + Intronic
916670474 1:167014084-167014106 TAAATGGTAACTGATGAAGCTGG - Intronic
918716837 1:187800055-187800077 TAAATGTTGGCTTATTAAGAAGG - Intergenic
919268634 1:195308999-195309021 TAAATATTGGTTGGTGATGATGG - Intergenic
919417074 1:197324164-197324186 TTAATTGTGGTTGATGATGATGG + Intronic
919974257 1:202600583-202600605 TATATGGGGACTGGTGATGAGGG - Intronic
921114639 1:212077325-212077347 TAACTGGTGGCATCTGATGATGG + Intronic
922162119 1:223085777-223085799 TAAAATGGGGGTGATGATGATGG - Intergenic
924265314 1:242275811-242275833 TAAATGGGGTCACATGATGAAGG + Intronic
1063328876 10:5135262-5135284 TAAATGCTGGATGTTGAAGAAGG - Intergenic
1063571453 10:7217855-7217877 GCAAGGGTGACTGATGATGATGG - Intronic
1064061760 10:12143820-12143842 GAAATTGTGGCTGAGGATGCTGG + Intronic
1064725362 10:18273580-18273602 GAAATGGTGGCTAATAGTGATGG + Intronic
1065747548 10:28856053-28856075 TAAATGCTTTCTGATGATGTGGG + Intronic
1066236056 10:33485844-33485866 AAAATAAGGGCTGATGATGATGG + Intergenic
1066719507 10:38322679-38322701 TAAATGGGGTCACATGATGAAGG - Intergenic
1067303484 10:45036130-45036152 TAAATGTTGGGTGATGGTGGAGG + Intergenic
1067570514 10:47368057-47368079 GAAGTGGTGGAGGATGATGAGGG + Exonic
1067962282 10:50867545-50867567 GAAAAGGTGGTGGATGATGAGGG + Intronic
1068518121 10:58048819-58048841 TAAATTGTGGCTGACCATGGTGG + Intergenic
1068811812 10:61264302-61264324 TAAATGATTGCCGATGCTGATGG - Intergenic
1068844497 10:61656785-61656807 TAAATGGTAGAGCATGATGATGG - Intergenic
1070272445 10:74969318-74969340 TAGATGGTGGTTGATGAAGACGG + Intronic
1071006868 10:80893582-80893604 AAAATGGTGGCTGGTCATGGTGG + Intergenic
1071114048 10:82195863-82195885 CAAAAGGTGGCTGCAGATGAAGG + Intronic
1074688601 10:115982153-115982175 CAAATGGTGACAGATGAGGAAGG - Intergenic
1075252017 10:120887670-120887692 TTAATGCTGGCTGTTGACGAGGG + Intronic
1075864562 10:125706523-125706545 TTGATGGTGGGTGATGGTGACGG + Intergenic
1076243818 10:128930820-128930842 CAAGTGGTGGCTAATAATGAGGG - Intergenic
1076702694 10:132282374-132282396 TTTCTGGTGGCTGATGAAGAGGG + Intronic
1077546720 11:3174635-3174657 ACAATGATGGTTGATGATGATGG - Intergenic
1078279951 11:9891153-9891175 TAAATGGTGGCTTGTGGTGAAGG + Intronic
1078661992 11:13295237-13295259 TAGATGCTGGCTGATGACCAAGG + Intronic
1080063499 11:27982374-27982396 TAAATAGTAGGTGATGATGAAGG - Intergenic
1081645454 11:44786960-44786982 TAAATGGTGGCAGAGGAAAATGG - Intronic
1083706635 11:64521000-64521022 TGAATTGTAGCAGATGATGATGG - Intergenic
1084887892 11:72222927-72222949 TAAAAGGTGGCTGATGAGAACGG + Intergenic
1085041291 11:73327971-73327993 TAAAATGGGGATGATGATGATGG + Intronic
1085780967 11:79408745-79408767 AAAATGGTGGCTGATGAAAAAGG + Intronic
1087158530 11:94927216-94927238 TAAATGGTGGCTGGTGACACAGG - Intergenic
1087212889 11:95461395-95461417 GGAATGGGGGCAGATGATGAGGG + Intergenic
1088819407 11:113444646-113444668 TAAATGGTGGCTGATGATGACGG + Intronic
1089246371 11:117123520-117123542 GAATTGGTGGCTGATAAGGAGGG + Intergenic
1089739577 11:120573202-120573224 TAAATGTTTGTTGTTGATGATGG + Intronic
1090162771 11:124512908-124512930 TAAACGGTGAATGATGATGGAGG + Intergenic
1090262592 11:125332175-125332197 TAAATGGTGGTTGATACAGATGG + Intronic
1090595879 11:128320890-128320912 TAAAAGATGGATGATGGTGATGG + Intergenic
1091113886 11:132995994-132996016 TCCATGGTGGATGGTGATGAGGG + Intronic
1091297482 11:134483971-134483993 TAGAGGGTGGTTGAAGATGAGGG + Intergenic
1091832930 12:3563098-3563120 TAAGTGGTGGGTGATGATCTCGG + Intronic
1092053777 12:5492171-5492193 AGAATGCTGGCTGATGCTGATGG - Intronic
1094725784 12:33114345-33114367 AAAATGGTAGATGGTGATGAAGG - Intergenic
1096960899 12:55576345-55576367 TACATAGTAGCTGATGATGTGGG + Intergenic
1098106411 12:67072102-67072124 TCAATGTTAGTTGATGATGATGG + Intergenic
1098998649 12:77150746-77150768 TAAATGATTGATAATGATGATGG - Intergenic
1099006899 12:77244594-77244616 TAAATGGTTGATGATGACAATGG + Intergenic
1100344247 12:93711553-93711575 TAAAATGTGGCTGATAAAGAGGG - Intronic
1100864707 12:98844456-98844478 TGAAGAGTGGCTGATGATGCAGG - Intronic
1100868138 12:98879907-98879929 GAAATCTTGGCTGATGGTGAGGG - Intronic
1101772812 12:107767220-107767242 TGACTGGTGTCTGATGAGGAAGG - Intergenic
1101844653 12:108352988-108353010 TGAGTGGTGACTGATGCTGAAGG + Intergenic
1102810177 12:115817469-115817491 TTAATAGTGTCTGGTGATGATGG - Intergenic
1102834956 12:116047612-116047634 AAAATAGAGGCTGATGATAACGG + Intronic
1103201262 12:119089826-119089848 TATATGTTTGATGATGATGATGG - Intronic
1106052142 13:26201478-26201500 TAAATGGTGGGGGATGTTGGGGG + Intronic
1106491998 13:30234626-30234648 TAAAGGGTGGTTGATGATCTGGG - Intronic
1107549388 13:41460573-41460595 TCAATGATGGCTGTTTATGAAGG + Intronic
1108905411 13:55464986-55465008 TAAAATGTAGCTGATGAAGAAGG - Intergenic
1112382449 13:98905206-98905228 AAAATGATGGCTGATCTTGAAGG + Intronic
1114451741 14:22830987-22831009 TAATTGGTGACTGAGGAAGATGG + Intronic
1115041191 14:28930692-28930714 GAAATGGTGGCTGATTACAAAGG - Intergenic
1116296303 14:43115233-43115255 TAAATGGTTGTTGATGAGGCAGG + Intergenic
1116310410 14:43318343-43318365 TAAAGGGTAGCTGATTATGCTGG - Intergenic
1116926476 14:50643359-50643381 TAAATCATGGCAGAAGATGAAGG + Intronic
1117997686 14:61493324-61493346 TAAATGGTTGCTGAAGATCTAGG + Intronic
1118773031 14:68955067-68955089 TAGAGGGAGGCTGATGATGGGGG - Intronic
1121583704 14:95048674-95048696 TAGGAGGTGGCAGATGATGATGG - Intergenic
1122915926 14:104858964-104858986 GAAATGGTGGGTGGTGATGGAGG - Intergenic
1122916067 14:104859540-104859562 GAAATGGTGGGTGGTGATGGAGG - Intergenic
1122916142 14:104859850-104859872 GAAATGGTGGGTGGTGATGGAGG - Intergenic
1122916218 14:104860210-104860232 GAAATGGTGGGTGGTGATGGAGG - Intergenic
1122916263 14:104860416-104860438 GAAATGGTGGGTGGTGATGGAGG - Intergenic
1122916299 14:104860572-104860594 GAGATGGTGGGTGATGATGGAGG - Intergenic
1124888911 15:33713402-33713424 ATGGTGGTGGCTGATGATGATGG + Intronic
1125996499 15:44166282-44166304 TATATAATGGATGATGATGATGG + Intronic
1128393334 15:67198181-67198203 GAAATGGTGGCAGATGAGGATGG - Intergenic
1128429799 15:67581145-67581167 TAAATTGTGGCTCATGATGGTGG + Intronic
1129911466 15:79230898-79230920 TACATCATGGCTGATGGTGAAGG + Intergenic
1131732229 15:95294417-95294439 TCAATAGTGGATGAAGATGATGG - Intergenic
1133840983 16:9409052-9409074 TAAATGGTGACTGATGAGGAAGG - Intergenic
1136700649 16:32137122-32137144 TAACATGTGGCAGATGATGATGG + Intergenic
1136767009 16:32790343-32790365 TAACATGTGGCAGATGATGATGG - Intergenic
1136801140 16:33080358-33080380 TAACATGTGGCAGATGATGATGG + Intergenic
1137424274 16:48364400-48364422 TAAATGAGGGCTGAGGGTGACGG + Intronic
1137451284 16:48577116-48577138 TGAATGGGGGCAGATGAGGAAGG - Intronic
1139092361 16:63663592-63663614 TGAATGGTGGTTCATGATCAAGG + Intergenic
1141449217 16:84086205-84086227 AAAAAGCTGGCTGGTGATGAAGG + Intronic
1142128825 16:88423077-88423099 TAGATGGATGATGATGATGATGG + Intergenic
1203069404 16_KI270728v1_random:1052589-1052611 TAACATGTGGCAGATGATGATGG - Intergenic
1144093627 17:11880590-11880612 TGAGTGCTGGCTCATGATGAGGG + Intronic
1144532077 17:16049295-16049317 GAGATGGTGTCTGATGTTGAAGG - Intronic
1145253548 17:21310358-21310380 TGAATGGTGGCAGATGGTTATGG - Intronic
1145323029 17:21777603-21777625 TGAATGGTGGCAGATGGTTATGG + Intergenic
1150313330 17:64147242-64147264 TAAATGTGGGCTGAAGATAATGG + Exonic
1154204674 18:12326779-12326801 TAAAAGGTGGCTGCGGATGGAGG - Intronic
1155324601 18:24653091-24653113 TAACTGGGGGCTGATCATGTAGG - Intergenic
1158203880 18:54969478-54969500 TAAATTTTGTTTGATGATGATGG + Intergenic
1158749940 18:60247177-60247199 TAAATGGTGCTTGATAATGATGG + Intergenic
1159253939 18:65921059-65921081 AAAATGCAGGATGATGATGATGG + Intergenic
1161932561 19:7350407-7350429 TGAAATGTGGCTGATTATGAGGG - Intronic
1164926556 19:32135155-32135177 TAACTAGTGTCTGATGATCAGGG - Intergenic
1166095123 19:40533579-40533601 TAAATGGTGGCATATGGCGAAGG + Intronic
1166441568 19:42819860-42819882 TCACTGGTGGCTGTTGAGGATGG + Intronic
927219550 2:20694620-20694642 TAAAAAGTGGCTGAGGATGGAGG + Intronic
928035687 2:27820697-27820719 TAAATCTTGGCTGATCATGCTGG - Intronic
928750239 2:34462036-34462058 TTTATGGTAGCTGATGATGTTGG - Intergenic
929357107 2:41038880-41038902 TAAATGGGGACTGATGATCCAGG - Intergenic
931195912 2:60052254-60052276 GAAATGCTGCCTGATGAAGAAGG + Intergenic
932284178 2:70518700-70518722 CAATGGGTGGTTGATGATGAAGG - Intronic
932453845 2:71833625-71833647 GTACTGGTGGCTGATGATAATGG - Intergenic
932956312 2:76355792-76355814 AATATGGTGGCTGTTGTTGATGG - Intergenic
935405740 2:102707352-102707374 TAAATGATGGCTGGTGGTAAAGG + Intronic
935663034 2:105486257-105486279 TGAATGGTGGCTGAGGAAGGAGG - Intergenic
937764341 2:125641979-125642001 TAAATTGTACCTAATGATGATGG + Intergenic
939090077 2:137770059-137770081 TTAATGTTGGCTGCTGATAAAGG + Intergenic
940178975 2:150910862-150910884 TAATTGGTGATTGATGATGAAGG - Intergenic
942287688 2:174437277-174437299 GAAATGGTGGATGAAGATCAAGG + Intronic
943251801 2:185531504-185531526 TATATGGTGGGAGATGGTGATGG - Intergenic
944208428 2:197181967-197181989 TCAGTGGTGAATGATGATGATGG - Intronic
944677361 2:202044824-202044846 TAAAGGGGAGCAGATGATGAGGG + Intergenic
945565262 2:211390154-211390176 TAATTGGTGTTTAATGATGAGGG - Intronic
945773220 2:214071742-214071764 CAAATGGGAACTGATGATGAAGG - Intronic
1169261420 20:4141222-4141244 AAAATGTTGGCTGAAGATCAGGG + Intronic
1174565422 20:51461263-51461285 GAAAGGGGGGCTGATGAGGAGGG - Intronic
1175435262 20:58942564-58942586 TAGCTGGTGGCTGATGTAGAGGG - Intergenic
1176925382 21:14743243-14743265 TAAATGGTAGCTGCCTATGAAGG - Intergenic
1177162393 21:17562243-17562265 TGACTGGTGGCTGATCAGGATGG + Intronic
1177188478 21:17823621-17823643 TAAATGGTGACTGAATGTGAAGG + Intergenic
1177462240 21:21427840-21427862 TAGAAGGAGGCTGATGATCAGGG + Intronic
1183196151 22:36354909-36354931 TAAGTGGTAGATGATGATGCTGG - Intronic
1183777106 22:39973547-39973569 TGAATGGAGGCTGATGAGCAAGG - Exonic
949119413 3:367866-367888 CACATGTTTGCTGATGATGATGG + Intronic
951698633 3:25471917-25471939 TAGAGGGGGGCTGATGAAGAAGG - Intronic
952419490 3:33118484-33118506 GAAGTGGTGGGTGGTGATGAGGG - Intronic
953204648 3:40814118-40814140 TGAATTGTGCCTGATGATGAAGG + Intergenic
953204997 3:40818505-40818527 TTGATGGTTGCTGATGATGGTGG + Intergenic
953428810 3:42819804-42819826 TAAATGGTGGGTGAGCAGGAGGG - Intronic
954831474 3:53425002-53425024 AAGGTGGTGGCTGAAGATGAAGG - Intergenic
955844731 3:63150250-63150272 AAAATGGTGGCTGATTATAAAGG + Intergenic
956467451 3:69533537-69533559 TAACTGGTGTCTGATGATAATGG - Intronic
956555897 3:70522033-70522055 TAATAGGTGGCTGAAGATGAGGG + Intergenic
956788122 3:72659748-72659770 AAAATTGTTGTTGATGATGATGG - Intergenic
958893063 3:99801767-99801789 GAAATGTTGGGTGATGGTGAAGG + Intergenic
959686696 3:109155084-109155106 TAAATGGGTACTGATGAGGATGG + Intergenic
960315765 3:116174817-116174839 TAAATGGTGGGTGATTTTGAAGG - Intronic
960444183 3:117727408-117727430 TAAATGGTAGCTGATGAAGGAGG - Intergenic
961430462 3:126878814-126878836 TCAAAGGTGGCTGGTGATGCAGG - Intronic
962856786 3:139353779-139353801 TAATTGGGGGCTGGTGTTGATGG + Intronic
963228581 3:142888255-142888277 GAAAGGGAGGCTGATGTTGATGG + Intronic
963498034 3:146093998-146094020 TAAATGGGGGGTGGTGATGGTGG - Intronic
966018039 3:175167458-175167480 AGAATGGTGACTGAAGATGATGG - Intronic
969168244 4:5336343-5336365 TAATTGGGAGCTGATAATGAAGG - Intronic
969271664 4:6107376-6107398 TCTATGGTGGCTGATGTTGTGGG + Intronic
970621302 4:17821994-17822016 TAAAAGGTAGCTGATGGTGGTGG + Intronic
975386416 4:73764980-73765002 TAAAAGGTGGCAGATGAATATGG - Intergenic
975483220 4:74905138-74905160 TAAATGGTGGCTCTTGAAAATGG + Intergenic
975932031 4:79536636-79536658 GGAATGGTGGCTGATTAGGAAGG + Intergenic
976620296 4:87120432-87120454 TAAAAGGTGGCAGCTGATCAAGG - Intronic
976761744 4:88556695-88556717 TAATTGGTGTCTGAGGAAGATGG - Intronic
977249940 4:94678685-94678707 TAAATGGAGCATGATGAAGAAGG + Intergenic
978717441 4:111862991-111863013 TACAGTGTTGCTGATGATGATGG + Intergenic
980336614 4:131482239-131482261 CAAATGCTGGCTGCTGATGGAGG + Intergenic
981545675 4:145890827-145890849 TAAATGGATTCTGAAGATGAAGG + Intronic
982465640 4:155727135-155727157 AAAATGGTGTCTGGTGAAGAAGG + Intronic
982970457 4:161977787-161977809 TGAATTGTGGCTGATTATAAAGG - Intronic
983237170 4:165192815-165192837 TGAATAGGGGCTGATCATGATGG - Intronic
983738359 4:171091975-171091997 TACATGATTGCTGATGATAAAGG + Intergenic
984738894 4:183139754-183139776 TATATGGTGGCAGATGACGGGGG - Intronic
985021928 4:185700869-185700891 TAAATAGTGGCAGAGCATGAAGG - Intronic
987500260 5:18699878-18699900 TTAATGATGACAGATGATGAAGG - Intergenic
987674239 5:21053387-21053409 TAAATGGTGGCACACCATGAAGG + Intergenic
988203232 5:28097168-28097190 GAAATGGTGGCTGGGGATGGTGG - Intergenic
992218743 5:74550771-74550793 AACATGTTGGATGATGATGAGGG - Intergenic
992567302 5:78010928-78010950 TAAATGCTTTTTGATGATGATGG + Intronic
995831893 5:116362745-116362767 TAAATGCTGACCGAGGATGAGGG + Intronic
996957384 5:129200540-129200562 TAAATGGTTTATGATGCTGAGGG - Intergenic
997750529 5:136340936-136340958 TAAATGGTTGCTGATTTTGTAGG - Intronic
998078903 5:139258555-139258577 TAAACAGTGGGTGATGAGGAAGG + Intronic
998684084 5:144504596-144504618 TAATTGGTGTCTAATAATGATGG - Intergenic
999871934 5:155761517-155761539 GAGATGGTGACAGATGATGATGG - Intergenic
1000365205 5:160484343-160484365 TAGCTGGAGGCTGATGGTGAGGG + Intergenic
1003233362 6:4274542-4274564 TCAATGGTGGCTGGTGATATTGG - Intergenic
1004915193 6:20325434-20325456 TAAATTGTCACTGATCATGAAGG + Intergenic
1005565208 6:27085726-27085748 TGAATGGTGGTTGGTTATGATGG - Intergenic
1006024854 6:31140195-31140217 GAGATGGTGGCTCAGGATGATGG - Intergenic
1006431556 6:34000428-34000450 TCAATGGTGCCTGCTAATGAAGG + Intergenic
1007408930 6:41650373-41650395 CAATTGATGGCTGATGAGGAGGG - Intronic
1008175572 6:48264349-48264371 GAAATGGAGGCTGATGAGAAAGG - Intergenic
1008871120 6:56272814-56272836 AAAATTGTGGCAGAAGATGAAGG - Intronic
1013834318 6:114315026-114315048 GAAATGGTGGAGGATGATGGAGG - Intronic
1013930564 6:115526781-115526803 TCAATGTTGGCTGATGATATTGG + Intergenic
1014030609 6:116698300-116698322 TAAATTGTGGTTGATAATGAAGG + Intronic
1014644566 6:123957065-123957087 CAGATGGTGGAGGATGATGATGG - Intronic
1015172751 6:130272019-130272041 TAAAAGATGGATGATGATGATGG - Intronic
1015812220 6:137172082-137172104 TAAATGGGGGATGATAATGTGGG + Intronic
1015957373 6:138612955-138612977 TAAACGATGGCTCATGATGAAGG - Intronic
1021396800 7:20159273-20159295 CAAATGGTGGCAGCTGGTGACGG + Exonic
1024426538 7:49232471-49232493 TAAACTTTGGGTGATGATGATGG + Intergenic
1029834252 7:103292452-103292474 ACAATGGTTGCTGGTGATGAGGG - Intergenic
1030528650 7:110684692-110684714 GAAATTTGGGCTGATGATGAAGG + Intronic
1032409187 7:131681474-131681496 TAAACTGAGGATGATGATGATGG + Intergenic
1033553468 7:142468498-142468520 TAAATGGTGGAGGCAGATGAAGG + Intergenic
1033557922 7:142505172-142505194 TAAATGGTGGAGGCAGATGAAGG + Intergenic
1034833377 7:154329329-154329351 TAAAATGTGGCTGGTGATCAGGG + Intronic
1034840578 7:154391740-154391762 TAAAGTGTGGGTGCTGATGAAGG + Intronic
1035855668 8:2973810-2973832 TTAATGGTGGTAGAGGATGATGG + Intronic
1035965169 8:4184016-4184038 TTAATGTTTGCTGATAATGATGG + Intronic
1038343744 8:26712786-26712808 TAACTGCTGGCTGATGATTTTGG - Intergenic
1043493726 8:80777476-80777498 TAATTGGTGACTGAAGGTGAAGG - Intronic
1043515190 8:80989599-80989621 TATATGGTGGATGAGGAAGAAGG + Intronic
1044785377 8:95787449-95787471 GAAGTGGTGGCTGATGGGGAGGG + Intergenic
1046182045 8:110662968-110662990 TAAGTGGTAGTCGATGATGATGG - Intergenic
1046707509 8:117471509-117471531 TAAATGCTATGTGATGATGATGG + Intergenic
1047218372 8:122898057-122898079 TAAATGGTGGCTTATTTTCACGG - Intronic
1047257716 8:123228239-123228261 TAATTAGTGGAAGATGATGAGGG - Intronic
1047771041 8:128030002-128030024 TACTTGGTGGCTGAAGAGGAAGG + Intergenic
1051582933 9:18696397-18696419 AAAATGGTGGGAGATGAAGATGG + Intronic
1051788434 9:20772210-20772232 GAAATGGTAGCTGATGTTGGAGG + Intronic
1060100338 9:120834823-120834845 TAAATGGTGAGAGGTGATGAAGG + Intronic
1061082930 9:128383029-128383051 TAAAGGGTGGCTGGTGAGGGAGG + Intronic
1186170084 X:6867556-6867578 ATAATGGTGGATGGTGATGATGG + Intergenic
1186545658 X:10446524-10446546 TAAATAGTGGATTAAGATGAGGG - Exonic
1187187414 X:17000233-17000255 AAAATGGGGGCTGAGGAAGAAGG + Intronic
1188403431 X:29776321-29776343 CAAATTGTGACTGATGATTAGGG - Intronic
1188960261 X:36482769-36482791 TAAATGTTTGCTGATGATGATGG + Intergenic
1189353450 X:40294376-40294398 GCAATGGTGGCTGTTGATGCCGG + Intergenic
1192294132 X:69829025-69829047 ATAATGGGGGATGATGATGAAGG - Intronic
1194940387 X:100002195-100002217 TTAATGGCTGCTGATGATCAGGG - Intergenic
1196141875 X:112272154-112272176 GAAATGTTGGCTGATGAGTACGG - Intergenic
1197800744 X:130345315-130345337 TAGATGGTAGCTTATGATGATGG + Intronic
1198601507 X:138289020-138289042 TCAATGTTTGTTGATGATGATGG - Intergenic
1198922137 X:141741096-141741118 TAAATGTTTGCTGAGAATGATGG - Intergenic
1201560429 Y:15310409-15310431 TTGATGGATGCTGATGATGATGG + Intergenic