ID: 1088820151

View in Genome Browser
Species Human (GRCh38)
Location 11:113449609-113449631
Sequence ATGCTGGGCTAGCAGAGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088820148_1088820151 14 Left 1088820148 11:113449572-113449594 CCATCATAGGTGCACAGTAAAAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1088820151 11:113449609-113449631 ATGCTGGGCTAGCAGAGTGACGG 0: 1
1: 0
2: 2
3: 19
4: 186
1088820147_1088820151 26 Left 1088820147 11:113449560-113449582 CCTGAGCACATGCCATCATAGGT 0: 1
1: 0
2: 2
3: 8
4: 92
Right 1088820151 11:113449609-113449631 ATGCTGGGCTAGCAGAGTGACGG 0: 1
1: 0
2: 2
3: 19
4: 186
1088820145_1088820151 27 Left 1088820145 11:113449559-113449581 CCCTGAGCACATGCCATCATAGG 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1088820151 11:113449609-113449631 ATGCTGGGCTAGCAGAGTGACGG 0: 1
1: 0
2: 2
3: 19
4: 186
1088820143_1088820151 29 Left 1088820143 11:113449557-113449579 CCCCCTGAGCACATGCCATCATA 0: 1
1: 0
2: 1
3: 19
4: 345
Right 1088820151 11:113449609-113449631 ATGCTGGGCTAGCAGAGTGACGG 0: 1
1: 0
2: 2
3: 19
4: 186
1088820144_1088820151 28 Left 1088820144 11:113449558-113449580 CCCCTGAGCACATGCCATCATAG 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1088820151 11:113449609-113449631 ATGCTGGGCTAGCAGAGTGACGG 0: 1
1: 0
2: 2
3: 19
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088820151 Original CRISPR ATGCTGGGCTAGCAGAGTGA CGG Intronic
901652031 1:10748517-10748539 AGGCTAAGCTTGCAGAGTGACGG + Intronic
902054086 1:13585717-13585739 ATGCGGGGCTGGCTGAGTGAGGG + Intronic
902318950 1:15646144-15646166 CTCCTGGCCTAGCAGAGTGCGGG + Intronic
903735785 1:25529137-25529159 AGGCTGGGAGAGCAGAGGGAGGG - Intergenic
904285404 1:29450383-29450405 ATTATGGCCTGGCAGAGTGATGG + Intergenic
904756239 1:32770322-32770344 AGGCTGGGCTGGCCGAGTGCAGG - Exonic
904820548 1:33240755-33240777 AAGCAGTGATAGCAGAGTGATGG + Intergenic
906270333 1:44472833-44472855 GAGCTGGGCCAGCAGGGTGACGG + Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909837785 1:80278859-80278881 ATGCTGGATTAGCTTAGTGAAGG + Intergenic
911721591 1:101197065-101197087 ATGCGGGGGTAACAGAGTGTGGG - Intergenic
911873118 1:103125372-103125394 TTGCTGGCCTAAGAGAGTGATGG - Intergenic
912754314 1:112311789-112311811 ATGCTGGGCTCTCAGAGAGAAGG - Intergenic
914867670 1:151445763-151445785 ATCCTGAGATAGCAGAGTGTAGG - Intronic
916436487 1:164782399-164782421 ATCCTGGTCTAGCAGGGAGAAGG + Intronic
918239889 1:182611864-182611886 AGGCTGGGCCGGCAGAGTGGCGG + Intergenic
918472156 1:184885574-184885596 CTGCAGGGCCAGTAGAGTGAGGG - Intronic
918880945 1:190120026-190120048 ATGCTCGTCTAGCAGTTTGAAGG - Intronic
919929518 1:202212288-202212310 ATGGAGGGCGAGCAGAGGGAAGG + Intronic
921302411 1:213763836-213763858 ATGCTGGGAATTCAGAGTGAAGG - Intergenic
923629890 1:235642886-235642908 AAGCTGGGCAAGTAGAGAGAGGG - Intronic
1063240963 10:4168877-4168899 ATGCATGGCTCACAGAGTGAAGG - Intergenic
1066528579 10:36310163-36310185 ATGCTGCCCTAGCAGAATGATGG + Intergenic
1073028501 10:100506276-100506298 ATGCTGGGATGGGAGAGAGAGGG - Intronic
1074540504 10:114361590-114361612 GTGCTGGGTTTGCAAAGTGATGG + Intronic
1075035679 10:119065111-119065133 ATGATGGGCAAGAAGAGTCATGG - Intronic
1075732390 10:124644254-124644276 TAGCTGGGCTAGCACAGTCATGG + Intronic
1077337506 11:2012013-2012035 CTGCTGGTCTGGCAGAGGGAGGG + Intergenic
1078268399 11:9772373-9772395 ATGCGTGGCTAGCAAAGAGAAGG - Intergenic
1081025132 11:38003077-38003099 ATGCTGGGCTAGTTGATTGAAGG - Intergenic
1083996826 11:66277023-66277045 AGGAGGTGCTAGCAGAGTGAGGG - Exonic
1084311105 11:68316846-68316868 GTGCTGGGAGGGCAGAGTGAGGG + Intronic
1085602913 11:77871510-77871532 ATGCTGGGCTAGTAGGGGGTGGG + Intronic
1086290334 11:85301540-85301562 ATGCAGGGCTAGAACTGTGAGGG + Intronic
1088450310 11:109974667-109974689 ATGCTGAGCTAGCAGGGTGTAGG - Intergenic
1088820151 11:113449609-113449631 ATGCTGGGCTAGCAGAGTGACGG + Intronic
1089097040 11:115927749-115927771 ATGCTGGGCTCTCAGAGGGTAGG + Intergenic
1090882842 11:130849307-130849329 AAGCTGTGCTGGCAGACTGAAGG - Intergenic
1091362364 11:134987626-134987648 TTGCTGGGCCAGCAGACTGCAGG + Intergenic
1202820490 11_KI270721v1_random:67195-67217 CTGCTGGTCTGGCAGAGGGAGGG + Intergenic
1093128948 12:15366338-15366360 ATGGTGCCCTAGCTGAGTGAGGG + Intronic
1094466600 12:30760242-30760264 ATTCTAGGCTAACAAAGTGATGG - Intergenic
1095417932 12:41996155-41996177 ATGCTGGGGTAGCATGGTGCTGG - Intergenic
1096966791 12:55634751-55634773 ATGTTGAGAGAGCAGAGTGAGGG + Intergenic
1097173520 12:57129797-57129819 ATGCTGGGGTAGGAGGGTGGGGG + Intronic
1099164763 12:79290465-79290487 ATGTGGGGGTAGCAGAGTGGAGG + Intronic
1100699966 12:97137039-97137061 ATGCTGAGCTAGCACAATGCAGG + Intergenic
1101304365 12:103513033-103513055 ATGCTGGGCTGGCAGAGGAGTGG - Intergenic
1101414970 12:104500993-104501015 ATGCTGAGCTAGCGGAGGTAGGG - Intronic
1102693542 12:114780530-114780552 AAGTGGGGGTAGCAGAGTGATGG + Intergenic
1104761853 12:131301429-131301451 TTGCTGGGAGAGCAGAGTGGAGG + Intergenic
1104795354 12:131513382-131513404 ATGCTGGGCATGCAGAGTGAGGG - Intergenic
1104802180 12:131561423-131561445 CTTCTGGGATAGCAGAGTAAAGG + Intergenic
1104817923 12:131659355-131659377 TTGCTGGGAGAGCAGAGTGGAGG - Intergenic
1105249735 13:18687443-18687465 GTGAGGGGCTAGGAGAGTGATGG - Intergenic
1105775671 13:23657970-23657992 CTGCCGGGGAAGCAGAGTGAGGG + Intronic
1106591591 13:31103253-31103275 ATGCTGGGGTAGCACAGAGATGG + Intergenic
1107534969 13:41320307-41320329 TTGCTGGGGTAGGAAAGTGATGG + Intronic
1109071748 13:57778581-57778603 ATGCTGGAGTATCAGAGAGATGG + Intergenic
1116688519 14:48074310-48074332 GTGCTGTTCTTGCAGAGTGATGG - Intergenic
1117457397 14:55912107-55912129 AGGCAGGCCTAGCAGAGGGAGGG - Intergenic
1119974924 14:79014975-79014997 GTGCTGGGCTGACAGAGGGATGG - Intronic
1122482336 14:102055255-102055277 ATGCAGGAGGAGCAGAGTGATGG - Intergenic
1122626875 14:103089466-103089488 ATGATGGGGTGGCAGAGGGAAGG - Intergenic
1122810271 14:104284294-104284316 AGGCTGGGCTTGCAGAGGAAGGG + Intergenic
1126557673 15:50007316-50007338 AGTCTGGGCTACCAGAGTTAGGG - Intronic
1128341365 15:66824685-66824707 ATGCTGGGCTAGCTTGCTGAAGG + Intergenic
1130971668 15:88738725-88738747 ATGCTGGGGGAGCAGAGAGGAGG - Intergenic
1131018709 15:89079778-89079800 ATGCTGAGCTAGAAGAAGGAGGG - Intergenic
1132718099 16:1302009-1302031 ATGCTGGGCCAGCACCGTGCTGG - Intergenic
1133143634 16:3767240-3767262 AAGCTGAGCATGCAGAGTGAGGG - Intronic
1133451868 16:5910587-5910609 GTGCAGGGCTAGCAGAGGCAGGG + Intergenic
1133842287 16:9420666-9420688 ATGTTGGGCTAGCAAAGAAAGGG + Intergenic
1135156753 16:20059314-20059336 AGGCTGGGCTAGGTGGGTGATGG - Intronic
1139550928 16:67672627-67672649 CTGCTTGGCCAGCAGGGTGATGG + Intergenic
1139562650 16:67753516-67753538 ATGATGGGCTAGCAATGGGAGGG + Intronic
1141962951 16:87421529-87421551 AGGCTGGGCTGCAAGAGTGAAGG + Intronic
1143495286 17:7308775-7308797 ATACTAGGCTAGTAGAGTTAAGG - Intronic
1143497016 17:7318202-7318224 GAGCTGGGCTAGAAGGGTGAGGG + Intronic
1145271300 17:21406276-21406298 ATGCAGGGCTTGCACAGTGTTGG + Intronic
1146513224 17:33468829-33468851 TTGCTGAGCTTGCAGAGTGAAGG + Intronic
1147364861 17:39953003-39953025 AGGCGGGGCTGGCGGAGTGAAGG + Intergenic
1147376005 17:40022881-40022903 ATGCTGGGGTGGCAGGGTGTAGG - Intronic
1147566767 17:41541238-41541260 ATGGTGGGGCAGCAGAGGGAAGG - Intergenic
1150763199 17:67980717-67980739 AGGCTGGGCCTGCACAGTGAAGG + Intronic
1150966806 17:69979887-69979909 ATACTGGGGCAGCAGTGTGAGGG - Intergenic
1152159189 17:78656785-78656807 ATGCTGGGCTAGGAGTCTGGGGG - Intergenic
1153559664 18:6359285-6359307 ATGCCTGGCTAGCAGAGACAGGG - Intronic
1154439097 18:14371447-14371469 GTGAGGGGCTAGGAGAGTGATGG + Intergenic
1154493121 18:14936434-14936456 TTGCTGGGCCAGCAGATTGCAGG - Intergenic
1157051938 18:44176368-44176390 ATGCTGGGCACCCAGAGTGTGGG - Intergenic
1157697498 18:49734413-49734435 ATGCTGGGCTAGCAGTTTTCTGG + Intergenic
1158186928 18:54781008-54781030 ATGCTGGGCATGCACAGTGTGGG + Intronic
1160107044 18:75987874-75987896 ATTCTGGGCTGTCACAGTGAGGG - Intergenic
1160761080 19:784822-784844 CTGCTGGACCAGCAGAATGAGGG + Intergenic
1160915645 19:1495297-1495319 ATACAGGCTTAGCAGAGTGACGG - Exonic
1161666163 19:5578314-5578336 ACGCTGGGCGGGCAGAGAGATGG + Intergenic
1163212466 19:15851337-15851359 ATGCAGGGTTGGCAGAGTGGGGG - Intergenic
1165427246 19:35752964-35752986 ATGATGGGCTGGCTGAGGGAGGG + Exonic
1166344596 19:42157322-42157344 ATGCTGGGTTAGGGGAGAGAGGG - Intronic
925547068 2:5028265-5028287 AAGCTGGGCTAGATGAGTGGAGG - Intergenic
928478034 2:31651446-31651468 ATGCTGGCCAAGCAGACTTATGG + Intergenic
928607062 2:32952824-32952846 AGGCTGGGCTGGCAGGGTTATGG + Intronic
929061667 2:37930813-37930835 AGGAGGTGCTAGCAGAGTGAGGG + Intronic
932591895 2:73072339-73072361 ATTTTGTGCAAGCAGAGTGATGG - Intronic
933001304 2:76927178-76927200 ATGCAGGTCTAGCAAAGGGAGGG - Intronic
934151973 2:89155649-89155671 ATGCTGGGCTTGCTGAGCGATGG + Intergenic
934215284 2:90026258-90026280 ATGCTGGGCTTGCTGAGCGATGG - Intergenic
934759211 2:96844276-96844298 AATCTGGGCTAGCAGTGTGTTGG - Intronic
936625215 2:114141366-114141388 ATGTTGGGCTAGCACAGTGTGGG + Intergenic
936944144 2:117915340-117915362 ATGTTGGGCTGGCAGAGGGAGGG - Intergenic
939997953 2:148937743-148937765 ATGGTGGGCTAGCAGGGAAAAGG + Intronic
940438890 2:153690538-153690560 ACCCTGGTCTACCAGAGTGATGG + Intergenic
944825025 2:203474127-203474149 CTGCTGGGGTCGCAGTGTGAGGG + Intronic
947872612 2:233447821-233447843 GTGCTGGGATCGCAGACTGAAGG + Intronic
947909011 2:233789653-233789675 CTCCTGGGCTGGCAGAGGGAAGG - Intronic
948720607 2:239897843-239897865 AGGCTGGGATGGCAGAGGGAGGG - Intronic
949031100 2:241797916-241797938 ATGCTGAGCTTGCCGAGTGCAGG + Intronic
1170257853 20:14365636-14365658 GTGCAGAGCTAACAGAGTGAAGG - Intronic
1170907431 20:20528652-20528674 ATGGTGGGGTAGCAGATGGATGG - Intronic
1171004875 20:21454524-21454546 AGGATGGGCTAGCAGAGGGAGGG + Intergenic
1174735801 20:52964591-52964613 ATGCTTGCCTATCATAGTGATGG - Intergenic
1174854138 20:54026850-54026872 GTGCTGGGGGAGCAGAGTGTGGG - Intronic
1175809973 20:61852656-61852678 GTGCTGGGGTAGGAGACTGATGG - Intronic
1176035940 20:63036458-63036480 ATCCTGGGCTTGCAGAGGGAGGG + Intergenic
1176456590 21:6917983-6918005 GTGAGGGGCTAGGAGAGTGATGG - Intergenic
1176834762 21:13783041-13783063 GTGAGGGGCTAGGAGAGTGATGG - Intergenic
1177015769 21:15784621-15784643 ATGGTGGGGTAGGGGAGTGAGGG + Intronic
1178047976 21:28717120-28717142 ATGCTGGGTTTGTAGAATGAGGG + Intergenic
1179086732 21:38225062-38225084 TTGCTGGGCTAGCAGATTTAAGG + Intronic
1180834660 22:18923841-18923863 ATGCTGGGCCATCAGGGTGAGGG - Intronic
1181065230 22:20302670-20302692 ATGCTGGGCCATCAGGGTGAGGG + Intergenic
1181853725 22:25768226-25768248 ATTCTGGGCAAGGAGAGCGAGGG + Exonic
1181865118 22:25848578-25848600 ATGATGGGCTGGCAGGGGGATGG + Intronic
1184130689 22:42514924-42514946 ATACTGGGCAGGCAGAGCGAGGG - Intronic
1184140868 22:42576754-42576776 ATACTGGGCAGGCAGAGCGAGGG - Intergenic
1185166822 22:49266496-49266518 CTGCTGGGGTCACAGAGTGAGGG - Intergenic
1203284749 22_KI270734v1_random:149140-149162 ATGCTGGGCCATCAGGGTGAGGG - Intergenic
951118831 3:18898916-18898938 AGGCTAGGCTAGCAGACTGGAGG - Intergenic
954746257 3:52789237-52789259 GTGCTGGGTTGGCAGCGTGAGGG + Intronic
957070643 3:75565217-75565239 ATGCTGGGCTGGTAGAGCCAGGG + Intergenic
957863958 3:85998138-85998160 ATGCTGGGGTAGCAGGGTTGGGG + Intronic
958976870 3:100678830-100678852 GTGCTGAGCTAGCCGAGGGAGGG + Intronic
960038362 3:113124352-113124374 CTGCTGGGCTGGGAGAGGGAGGG + Intergenic
960231288 3:115230325-115230347 ATGGTGGGCTGGGAGAGGGAAGG + Intergenic
960522128 3:118667354-118667376 AAGCTGGCCTAGCAGAGACACGG - Intergenic
961173803 3:124817780-124817802 ATACTGGGCTAGAACAGTAAAGG + Intronic
961438512 3:126936264-126936286 ATGCTGCCCTTGCAGAGCGAAGG + Intronic
962967276 3:140366575-140366597 TTGCTGGGGTAGAAGAGAGAGGG - Intronic
964616735 3:158673971-158673993 ATGATGGGCAAGCAGACAGATGG - Intronic
977386067 4:96340848-96340870 ATGCTGGGCTAACATGTTGAGGG + Intergenic
979058112 4:116019578-116019600 TTGCTGGGCTAGCAGATTATGGG - Intergenic
984567760 4:181351152-181351174 ATGCAGGGGTTGCAGAGAGAGGG + Intergenic
985866239 5:2516587-2516609 AGGTTTGGCCAGCAGAGTGAGGG - Intergenic
986407258 5:7438465-7438487 GTGCTGGGCTAGCAGAGAGAGGG + Intronic
986684191 5:10261260-10261282 AGGCTGGGTTCCCAGAGTGAGGG + Intronic
987113954 5:14712249-14712271 AGGCCGGGGCAGCAGAGTGACGG - Intronic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
994287135 5:97982702-97982724 ATGCTGGGATAGCAGACAAAAGG - Intergenic
997267421 5:132503041-132503063 TTTCTGGGCTAGAAGAGAGAGGG - Intergenic
998269051 5:140690670-140690692 ATTCTGGGATGGCAAAGTGATGG - Intronic
998417519 5:141956550-141956572 GTCTTGGGCTAACAGAGTGAGGG + Exonic
999950240 5:156641746-156641768 GTGCTGGACAAGCAGACTGAAGG - Intronic
1000464951 5:161564402-161564424 ATCCTAGGCCAGCAGACTGAAGG + Intronic
1003027200 6:2565454-2565476 ATTCTGGGCAAGCACAGTCAAGG + Intergenic
1004271424 6:14199538-14199560 TGGCTGGACTAGGAGAGTGAGGG + Intergenic
1005910705 6:30307083-30307105 AGTCTGGGCTAGCTGAGTTACGG + Intergenic
1006340297 6:33443079-33443101 ATGCTGGACTTACAGGGTGATGG + Exonic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1012420203 6:99056495-99056517 AAGATGGTCTAGCAGAGGGATGG + Intergenic
1013790035 6:113826006-113826028 CTGCTGGGCTGGCAGAGACAGGG + Intergenic
1014546503 6:122742452-122742474 TTGCTGGGCTAGAATAGTCAAGG + Intergenic
1015890754 6:137967756-137967778 GGGCTGGGATGGCAGAGTGATGG - Intergenic
1015890772 6:137967816-137967838 GGGCTGGGACAGCAGAGTGATGG - Intergenic
1015890789 6:137967886-137967908 AGGCTGGGACAGCAGAGTGATGG - Intergenic
1016624762 6:146153682-146153704 ATGCTGGGCTTACAAGGTGATGG + Intronic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1019184051 6:170210608-170210630 ATGGTGGGAAAGGAGAGTGAAGG + Intergenic
1021073555 7:16273337-16273359 AAGCTCCACTAGCAGAGTGATGG + Intronic
1022129279 7:27389241-27389263 GTGCTGGGCTAGGCGAGTGCTGG + Intergenic
1024024699 7:45400484-45400506 GTGCTGAGGTGGCAGAGTGAGGG - Intergenic
1025238947 7:57255708-57255730 AGGCTGGGGGAGCAGAGTGGTGG + Intergenic
1025816682 7:64920076-64920098 ATGTTGGGCCCCCAGAGTGATGG + Intronic
1025823276 7:64991410-64991432 TTGCTGGGCAAGCAGATTCAAGG + Exonic
1026452728 7:70543556-70543578 ATGCCAAGCTAGCAGAGAGAGGG + Intronic
1029164217 7:98575171-98575193 ATGCTGGGCTGTCAGAGGGCAGG - Intergenic
1032241257 7:130161003-130161025 AAGCTGGGCTAGCACAGTTGGGG + Intergenic
1033259134 7:139827093-139827115 ATGCTTGGCTAGAGGAGAGAGGG - Intronic
1037602055 8:20405506-20405528 ATGCTGGCCTGGCAGACTGGGGG - Intergenic
1039757226 8:40536654-40536676 AGGCTGGGCAAGCAGAGAGGTGG - Intronic
1042877211 8:73450012-73450034 ATGCCGGGCTGGCAGAGGCAAGG + Intronic
1043131093 8:76462343-76462365 ATTTTGGGCTAGAAGAGTTACGG - Intergenic
1044271869 8:90253795-90253817 TTGCTAGGCTAGCAGAGAGAGGG - Intergenic
1045922967 8:107554189-107554211 ATGCTAGATTAGCAAAGTGAAGG - Intergenic
1048697291 8:137041859-137041881 AAGCTGAGCTAGCAGGGAGAGGG + Intergenic
1048801069 8:138194147-138194169 ATGCAGGGCCAGCAGACTGTAGG - Intronic
1049534206 8:143170550-143170572 AAGCTGGCACAGCAGAGTGACGG + Intergenic
1051356232 9:16241852-16241874 ATCCATGGGTAGCAGAGTGACGG - Intronic
1051614838 9:18997330-18997352 CTGCTGCGCTAGCAGTGAGAAGG - Intronic
1052498355 9:29257494-29257516 GTGCTGGTCTGCCAGAGTGATGG - Intergenic
1053449324 9:38180004-38180026 CTGCTGGGCCAGCAGGGAGATGG + Intergenic
1056264024 9:84878072-84878094 GTGCTGGCCTACCTGAGTGAAGG - Intronic
1186506570 X:10098042-10098064 AAGCTGGACTAGCTGTGTGACGG - Intronic
1190765628 X:53473460-53473482 GTGCTGGGGGAGCAGGGTGAAGG + Intergenic
1197117273 X:122848583-122848605 AACATGGGCTAGAAGAGTGAGGG - Intergenic
1199136990 X:144265681-144265703 AGGATGGGCCAGCAGACTGAGGG - Intergenic
1199622462 X:149712961-149712983 ATCCTGGGCTGACAGAGGGAAGG + Intronic
1201589093 Y:15593836-15593858 GTGCTGTGCTAAAAGAGTGAGGG - Intergenic