ID: 1088821037

View in Genome Browser
Species Human (GRCh38)
Location 11:113457690-113457712
Sequence GCTGTGCGGACAGAGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088821037_1088821042 8 Left 1088821037 11:113457690-113457712 CCCCTGAGCTCTGTCCGCACAGC 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1088821042 11:113457721-113457743 GACCTCTGAAGTATCTAATTTGG 0: 1
1: 0
2: 0
3: 10
4: 104
1088821037_1088821046 30 Left 1088821037 11:113457690-113457712 CCCCTGAGCTCTGTCCGCACAGC 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1088821046 11:113457743-113457765 GAAATTATGGGCTGTCCGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 45
1088821037_1088821045 18 Left 1088821037 11:113457690-113457712 CCCCTGAGCTCTGTCCGCACAGC 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1088821045 11:113457731-113457753 GTATCTAATTTGGAAATTATGGG 0: 1
1: 0
2: 1
3: 27
4: 282
1088821037_1088821044 17 Left 1088821037 11:113457690-113457712 CCCCTGAGCTCTGTCCGCACAGC 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1088821044 11:113457730-113457752 AGTATCTAATTTGGAAATTATGG 0: 1
1: 0
2: 3
3: 30
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088821037 Original CRISPR GCTGTGCGGACAGAGCTCAG GGG (reversed) Intronic
900101592 1:964378-964400 GCTGAGCCGACGCAGCTCAGCGG + Exonic
903067891 1:20711002-20711024 GCTGTGAGGAGGGAGCCCAGAGG + Intronic
903134020 1:21297403-21297425 GCCGAGGGGACAGAGCCCAGTGG - Intronic
903318404 1:22526752-22526774 GATGTGCCGACAGCGCTCAGTGG + Exonic
904363195 1:29991769-29991791 GCTGTGGGGACTGAGCTCCATGG - Intergenic
904397298 1:30230382-30230404 CCTGTGGGGACAGGGCTGAGTGG + Intergenic
905425752 1:37882918-37882940 ACTGTGAGGACAGAGCACAAAGG + Exonic
906109235 1:43312285-43312307 GCTCTGGGGCCAGAGGTCAGGGG - Exonic
907260907 1:53217946-53217968 GCTGGGCTGTGAGAGCTCAGGGG - Intronic
911435708 1:97855106-97855128 GCAATGAGGACAGACCTCAGTGG - Intronic
914341215 1:146762132-146762154 GCTGTGGGAGGAGAGCTCAGTGG - Intergenic
915440114 1:155940687-155940709 AGTCTGTGGACAGAGCTCAGCGG - Intergenic
915525982 1:156476567-156476589 GCTGTGGGGACAGAGGTGTGGGG - Intronic
915720664 1:157983040-157983062 GCAGTGTGGACAGAGGGCAGCGG - Intergenic
916427859 1:164698885-164698907 CATGTGAGGACAGAGCACAGGGG + Intronic
918143446 1:181736621-181736643 GCTATGGGCACAGAGTTCAGAGG - Intronic
920688839 1:208130511-208130533 GCTGTGTGCACAGCGCTCGGAGG - Intronic
921801298 1:219405701-219405723 GCTGTGCTACCAGAGCGCAGAGG + Intergenic
922212303 1:223495565-223495587 GCTGTAGGGACAGAGTGCAGGGG - Intergenic
922250470 1:223845461-223845483 GCTGTGGGCGCAGAGCCCAGAGG + Intronic
922660889 1:227429476-227429498 ACTGTGCAGTCAGGGCTCAGAGG - Intergenic
1062995197 10:1859055-1859077 GCTGTGCAGTCAGGGCACAGAGG + Intergenic
1064519847 10:16189600-16189622 GCTGTGCATGCAGAGCTCTGGGG - Intergenic
1065960635 10:30731664-30731686 ACTGTGGGGCCAGAGCACAGGGG + Intergenic
1066309678 10:34184103-34184125 GATGTGCAGACTGAGCACAGTGG - Intronic
1067947485 10:50699180-50699202 GCAGTGAGGACAGAGTCCAGAGG - Intergenic
1068637391 10:59362665-59362687 GCTGCGGGGACAGAGCTGGGCGG + Intronic
1069038863 10:63673376-63673398 GCTGTGGGGCCAGAGCCCAGGGG + Intergenic
1070935033 10:80287151-80287173 CCTGTGCAGACACAGCTCACAGG + Intronic
1071481948 10:86071210-86071232 CCTGTGCTGAGAGAGCTCACTGG + Intronic
1072916196 10:99538683-99538705 GAGGTGCTGACAGAGCCCAGAGG - Intergenic
1075074414 10:119341302-119341324 GCTGTCAGGACAGAGTCCAGAGG + Intronic
1075878560 10:125828757-125828779 ACAGTTTGGACAGAGCTCAGTGG + Intronic
1076199628 10:128547607-128547629 GCTGTGAGGTCACAGCCCAGGGG + Intergenic
1076479065 10:130772495-130772517 GCTGTGTGGGCTGAGCACAGGGG - Intergenic
1076764209 10:132624283-132624305 GCTGTGGGCACAGAGATGAGCGG + Intronic
1076947003 10:133658328-133658350 CCTGTGCTGACACAGCCCAGGGG + Intergenic
1077018963 11:409101-409123 GCTGAGGGGACAGAGAGCAGTGG + Intronic
1080687442 11:34526943-34526965 TCTGGGCAGACAGAGCTCACAGG - Intergenic
1080882424 11:36334909-36334931 GTTTTGCAGTCAGAGCTCAGTGG - Intronic
1080882425 11:36334936-36334958 GTTTTGCAGTCAGAGCTCAGTGG - Intronic
1082923761 11:58524044-58524066 GCTGGGAACACAGAGCTCAGTGG - Intergenic
1084467960 11:69338113-69338135 GCTGTGCGTAGTGTGCTCAGTGG + Intronic
1084702692 11:70797642-70797664 CCCGTTTGGACAGAGCTCAGAGG + Intronic
1088821037 11:113457690-113457712 GCTGTGCGGACAGAGCTCAGGGG - Intronic
1089007035 11:115100828-115100850 GCTGTTAGCACAGAGCTCATTGG + Intergenic
1089131233 11:116213800-116213822 ACTGTGATGACAGAGCTCAGTGG + Intergenic
1090780344 11:130002105-130002127 GCAGTGCGGGCAGGGCTCCGGGG - Intronic
1096715405 12:53488124-53488146 GCTGGGGGGACAGAACTCTGTGG - Intronic
1096976175 12:55700355-55700377 GCTCTGTGCACAGGGCTCAGCGG - Exonic
1097741420 12:63247021-63247043 GCTGTGGGCACAGCCCTCAGAGG + Intergenic
1099246585 12:80200000-80200022 GATGTGCTTATAGAGCTCAGTGG - Intergenic
1102104892 12:110313033-110313055 GCTATTCTGACAGTGCTCAGGGG - Intronic
1103703491 12:122859672-122859694 CCTGTGAGGTCAGAGCTGAGAGG + Intronic
1103982060 12:124742963-124742985 GCTGTGTGGGCAGAGCTGGGCGG - Intergenic
1103988827 12:124784837-124784859 GCTGTGATCACAGAGCTCAAGGG - Intronic
1104096765 12:125565356-125565378 GCTGTGGGGCCGGAGCCCAGAGG - Intronic
1104460440 12:128951682-128951704 CCTGGGCGGACAGTGCACAGAGG - Intronic
1112344853 13:98580699-98580721 TCTGTGCGTGGAGAGCTCAGAGG + Intergenic
1112445972 13:99464618-99464640 TCTGTGAGGACAGACCTCTGTGG + Intergenic
1113569783 13:111345703-111345725 GCTGTGCAGATGGGGCTCAGCGG + Intergenic
1113683591 13:112262103-112262125 CCTATGAGGACAGAGCACAGAGG + Intergenic
1114619152 14:24084632-24084654 GCTGTGGGCACAGAGCCCAAAGG + Intronic
1116256710 14:42566382-42566404 GCAGTTCAGACAGAGCTCAGTGG - Intergenic
1116700481 14:48235396-48235418 TCTGTGCTGCCTGAGCTCAGTGG + Intergenic
1117321217 14:54625123-54625145 GCTGTGGGGAAAGAGCTGGGGGG - Intronic
1121665133 14:95666356-95666378 GCCTTCCTGACAGAGCTCAGAGG - Intergenic
1122972994 14:105159813-105159835 GGGGTGTGGACAGAGCTCTGGGG - Intronic
1202921066 14_KI270723v1_random:30877-30899 CCTGTGCTGACACAGCCCAGCGG + Intergenic
1202923843 14_KI270724v1_random:6697-6719 CCTGTGCTGACACAGCCCAGGGG - Intergenic
1124693221 15:31843092-31843114 GCTGTGAGGACAGAGCACAAGGG - Intronic
1125449438 15:39792773-39792795 GCTCTGCGGAGAGCACTCAGAGG - Intergenic
1126388792 15:48122671-48122693 GCTGAAGGAACAGAGCTCAGAGG - Intronic
1128444462 15:67745291-67745313 GCTGTGAGAGCAGAGTTCAGAGG - Intronic
1128841025 15:70852205-70852227 GGTGAGCTGACAGAGCCCAGTGG - Intronic
1129711120 15:77820573-77820595 GCTGGGAGGACAGGGCTCACGGG + Intronic
1130211241 15:81924776-81924798 GCTGTGTGGACAAAGCACTGAGG - Intergenic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1131231889 15:90665588-90665610 GCCGTGCGGCCGGAGCTCCGGGG - Intergenic
1131393164 15:92065930-92065952 GCAGTGAGGACACGGCTCAGAGG + Intronic
1132028637 15:98422605-98422627 TCTGGGCTGCCAGAGCTCAGCGG - Intergenic
1132802093 16:1759501-1759523 GCTGTGAGGACAGGGCTCCCTGG - Intronic
1134799480 16:17071357-17071379 GCTGGGTGAACAGAGCTGAGAGG + Intergenic
1136774181 16:32862815-32862837 GTTGAGGGGACAGAGCTGAGAGG + Intergenic
1136896430 16:33998699-33998721 GTTGAGGGGACAGAGCTGAGAGG - Intergenic
1137402995 16:48168415-48168437 GCTGTGGGAAAAGAGCTCAGTGG - Intronic
1137674617 16:50298148-50298170 GCTGTGCTGACAGGGCTTAGGGG - Intronic
1139993069 16:70955276-70955298 GCTGTGGGAGGAGAGCTCAGTGG + Intronic
1203076605 16_KI270728v1_random:1124934-1124956 GTTGAGGGGACAGAGCTGAGAGG + Intergenic
1143761028 17:9104516-9104538 GCTGTGAGGGCAGAGCAGAGGGG + Intronic
1144877965 17:18412209-18412231 GCTGTTGGGGCGGAGCTCAGGGG - Intergenic
1145154264 17:20532216-20532238 GCTGTTGGGGCGGAGCTCAGGGG + Intergenic
1145191074 17:20842488-20842510 GCCGAGCAGACAGAGCTCAGAGG - Intronic
1147120407 17:38332134-38332156 GCAGGGCAGGCAGAGCTCAGAGG + Intronic
1148887899 17:50786794-50786816 GCTGTGAGGTCGGATCTCAGAGG - Intergenic
1149344732 17:55723195-55723217 GCTGAGGGGACAGAGCCGAGGGG + Intronic
1149636760 17:58177149-58177171 GCTTTGCAGTGAGAGCTCAGAGG + Intergenic
1152408878 17:80112120-80112142 GCTGTGAGGGCAGAGCCCAGTGG - Intergenic
1155158842 18:23179506-23179528 GCTGTGTGCCCAGTGCTCAGAGG + Intronic
1155440153 18:25853947-25853969 ACTGTGCAGCCAGAGCTGAGAGG + Intergenic
1157331300 18:46705649-46705671 GCTGTGAGGAGAGGGCTCACCGG - Intronic
1161084049 19:2325783-2325805 GCTCTGCTGGCATAGCTCAGTGG + Intronic
1161400293 19:4064337-4064359 GCTGTGGAGACAGAGCTTGGGGG - Intronic
1161585836 19:5105012-5105034 GCTGCCCGGACGGAGCCCAGGGG - Intronic
1163554030 19:17982591-17982613 GCTCTGCGCACACAGCTCAGCGG - Intronic
1163612517 19:18308758-18308780 CCTGTGGGGACAGAGGCCAGAGG + Intronic
1166119568 19:40677461-40677483 GCAGTGCGGACAGGGGCCAGGGG + Intronic
1167339147 19:48904493-48904515 GCTGGGAGGGCAGAGTTCAGGGG + Intronic
1167673622 19:50870987-50871009 CCTGTGTGGTCAGAGCCCAGAGG + Intronic
929769255 2:44878335-44878357 ACTGTGTGACCAGAGCTCAGGGG + Intergenic
938064258 2:128272547-128272569 GCTGAGGGGACACAGCTGAGGGG + Intronic
938120742 2:128631488-128631510 GCTGTGGGGACCGAGCTTGGTGG + Intergenic
938549911 2:132370571-132370593 GCTGTGGGGCCAGAGCCCAGGGG - Intergenic
938738231 2:134205770-134205792 GATTTGAGGACAGAGCCCAGGGG + Intronic
942116588 2:172735245-172735267 GCAGTGCGGGCAGGGCTGAGGGG - Intergenic
943010788 2:182446271-182446293 GCTGTTCTAACAGAGCTGAGTGG - Intronic
943994064 2:194736375-194736397 GCTGTGAGGACAGTGATGAGAGG - Intergenic
944431150 2:199634800-199634822 CCTGTGCTGCCAGAGCTCTGTGG + Intergenic
945999086 2:216465795-216465817 GCTGTGGGGACTGAGATCTGGGG + Intronic
947490507 2:230590630-230590652 GCAGTTTGGACAGAGCTCAGTGG - Intergenic
948883458 2:240871681-240871703 GCCCTGGGGACAGAGGTCAGTGG - Intronic
1172302317 20:33858812-33858834 GCAGGGTGGAGAGAGCTCAGTGG + Intergenic
1173173993 20:40750560-40750582 GCTGAGTGGACTGTGCTCAGAGG + Intergenic
1173922226 20:46754900-46754922 GCAGAAGGGACAGAGCTCAGGGG + Intergenic
1175952343 20:62590291-62590313 GCTCTGGGGCCAGAGCTCCGTGG - Intergenic
1179164235 21:38923639-38923661 GCTGAGAGGACAAAGCTCACTGG - Intergenic
1179408773 21:41146095-41146117 GCACTGCGCACAGAGCTGAGTGG - Intergenic
1181274183 22:21678062-21678084 GATGTGGTGACAGAGGTCAGGGG + Intronic
1181636580 22:24177569-24177591 GCTGTTGGGGGAGAGCTCAGGGG - Exonic
1183081431 22:35459097-35459119 GCTGGGCGGACGGAGCAGAGTGG - Intergenic
1183379640 22:37484505-37484527 CCTGAGGGGACAGAGCCCAGTGG - Intronic
1184739566 22:46419556-46419578 GTTGTGGGGGCTGAGCTCAGAGG - Intronic
950475779 3:13214073-13214095 GCCGTGTGGACAGAGCACAGTGG - Intergenic
950573580 3:13817132-13817154 GGTGTGGGGACAGAGTTCAGAGG + Exonic
951114385 3:18843152-18843174 GCTGTTGGGATAGAGCTCACTGG - Intergenic
952861413 3:37815824-37815846 GCTATTTGGACTGAGCTCAGTGG + Intronic
953195018 3:40724096-40724118 GCTGTGTTGACTGAGCTTAGAGG - Intergenic
957080459 3:75632088-75632110 CCTGTGCTGACACAGCCCAGGGG - Intergenic
959164336 3:102758440-102758462 GCTGTGGGGACGGAGCCCAGGGG - Intergenic
960885032 3:122384584-122384606 GCTTTACAGACTGAGCTCAGGGG - Intronic
960915984 3:122695189-122695211 GAAGTGGGGACACAGCTCAGTGG + Intronic
961144758 3:124584688-124584710 GCGGTGCGGGGAGAGCACAGCGG + Intronic
961318740 3:126057896-126057918 GCTGTGGGGACAGAGGGAAGAGG - Intronic
964706137 3:159620675-159620697 GGTGTGAGGACAGAACTGAGTGG - Intronic
965597016 3:170419808-170419830 GCTGCGCGGACGGAGCTAGGAGG - Intronic
966206266 3:177409691-177409713 GCTGTGCTGACTGAACTCTGAGG - Intergenic
967413738 3:189194693-189194715 CCTGTGCCAACAGGGCTCAGTGG + Intronic
968620889 4:1603001-1603023 GCCGTCCGGACACAGCTCGGGGG + Intergenic
968736115 4:2297359-2297381 AGTGTGAGGACAGGGCTCAGAGG - Intronic
968739864 4:2322023-2322045 GATGTGGGGACACAGCCCAGGGG - Intronic
968973495 4:3809272-3809294 GCTGTCCGGGCATAGCACAGAGG + Intergenic
969669625 4:8582509-8582531 ACTGTGGGGACAGAGGACAGTGG - Exonic
972019371 4:34290868-34290890 GCTGTGGGGACAGAGCCTAGGGG + Intergenic
974131359 4:57760423-57760445 GCTGTACTGACAGAGGACAGAGG - Intergenic
976227122 4:82803965-82803987 GCCGTGCAGACAGAGCTATGAGG + Intergenic
978540848 4:109815224-109815246 ACTGTGCGGACAGGTCTCTGAGG - Intergenic
985450461 4:190059127-190059149 CCTGTGCTGACACAGCCCAGGGG + Intergenic
986753287 5:10810271-10810293 GATGTGTGGACAGAGTTCTGGGG + Intergenic
987119891 5:14757109-14757131 GATGGGAGGACAGACCTCAGAGG + Intronic
987504788 5:18754079-18754101 ACTGTGTGGCCAGAGCCCAGGGG - Intergenic
989719168 5:44504263-44504285 GCTGTGTGGCCAAAGCCCAGGGG + Intergenic
993699247 5:91098743-91098765 TATGTGCTGACAGAGCTTAGTGG - Intronic
996006616 5:118428750-118428772 TTTGGGCGGACAGAACTCAGGGG - Intergenic
996150770 5:120031887-120031909 GAAGTGAGGACAAAGCTCAGAGG - Intergenic
999230920 5:150061363-150061385 GCCTGGGGGACAGAGCTCAGGGG - Intronic
1001551727 5:172607601-172607623 GCGGTGGGGCCAGAGCTCTGAGG - Intergenic
1001564473 5:172690541-172690563 GCTGTGAGGATAGAGCAGAGAGG + Exonic
1002405605 5:179027800-179027822 GCTCAGGGAACAGAGCTCAGTGG - Intronic
1002558404 5:180062345-180062367 GCTGGGGGGACCGGGCTCAGTGG - Intronic
1002854768 6:1027034-1027056 GCTGTGAGGACAGAATTAAGTGG + Intergenic
1005681071 6:28208475-28208497 CCTGTGCGGAAAGTGCTCACTGG - Intergenic
1006130280 6:31864973-31864995 GCTGTGGGGACAGAGGGTAGGGG - Intronic
1011220451 6:85049336-85049358 GGGGTTTGGACAGAGCTCAGTGG - Intergenic
1013036677 6:106391804-106391826 GGTGTGCTGGCAGAGCTGAGGGG - Intergenic
1013342243 6:109226191-109226213 TCTGTACTGAGAGAGCTCAGTGG - Intergenic
1016701494 6:147059181-147059203 GCAGTGTGGACAGAGCCCAGTGG - Intergenic
1017525158 6:155236202-155236224 GGTATGTGGACAGAGCTCACGGG - Intronic
1017880051 6:158556262-158556284 GCTGTGCCAGCAGAGTTCAGAGG + Intronic
1019340582 7:507135-507157 GCTGAGGGGACAAAGGTCAGAGG - Intronic
1020012423 7:4813751-4813773 GCTGTGCGGGCTGTCCTCAGTGG + Intronic
1021927242 7:25545470-25545492 GCTGCCTGGCCAGAGCTCAGGGG - Intergenic
1025058385 7:55783782-55783804 GCTGTGTGAACTGAGCCCAGTGG - Intergenic
1028053043 7:86208430-86208452 GATGTGTGTACAGATCTCAGTGG + Intergenic
1029205071 7:98864949-98864971 GCTGTCGGGAAAGAGCTGAGGGG - Intronic
1030349533 7:108468656-108468678 GCTGGGGGGAAAAAGCTCAGAGG + Intergenic
1034353240 7:150430768-150430790 GTTCTGGAGACAGAGCTCAGTGG + Intergenic
1035744075 8:1948942-1948964 TGTGTGCGAACAGAGCACAGAGG - Intronic
1036177485 8:6552964-6552986 GCTGTGCAGGTAGAGCACAGAGG + Intronic
1038314753 8:26474773-26474795 GATGAGTGGACAGAGCACAGAGG - Intronic
1038428631 8:27482085-27482107 GATGTGCTGGCAGAGCCCAGAGG - Intergenic
1039072568 8:33660074-33660096 GCTGTGAGCTCAGAGCTGAGTGG + Intergenic
1044893356 8:96861367-96861389 GGAGTGCGGTCAGAGCTGAGAGG + Intronic
1045085573 8:98680197-98680219 GCTGTGCAGACAGAGCTAAGAGG + Intronic
1045420732 8:102012349-102012371 GCTTTGCTGACAGTGCTCTGTGG - Intronic
1045480409 8:102587051-102587073 GGTGTCCTGACAGAGCTCACGGG - Intergenic
1045499420 8:102733567-102733589 TGTGTGCATACAGAGCTCAGGGG - Intergenic
1047246428 8:123149115-123149137 TTTCTGCGGACAGAACTCAGCGG - Intronic
1049337481 8:142094169-142094191 GCAATGGGGACAGGGCTCAGGGG - Intergenic
1049356236 8:142189920-142189942 GCTGGGCAGACATTGCTCAGAGG - Intergenic
1049513805 8:143043165-143043187 GCTGTACGCACAGGGCCCAGGGG + Exonic
1052013481 9:23438644-23438666 GCTGTGGGAGCAGATCTCAGAGG - Intergenic
1054865294 9:69994110-69994132 GCTGTGATGACACAGCACAGAGG - Intergenic
1055988376 9:82077828-82077850 GCAGTGGGGACAGAGTTGAGAGG + Intergenic
1057694782 9:97315435-97315457 GCAGTGGGGACAGAGCCAAGAGG - Intronic
1059333028 9:113548519-113548541 GCAGTGGGAACAGAGCTGAGGGG + Intronic
1059458541 9:114414964-114414986 TCTGTGTGGAGAGAGCCCAGAGG - Intronic
1060185611 9:121562280-121562302 GCTGCGGGATCAGAGCTCAGTGG - Intergenic
1060232751 9:121837846-121837868 GCTGTGGGGAGAGAGCCAAGAGG - Intronic
1060479384 9:124009109-124009131 TCTCGGCGGACAGGGCTCAGCGG + Intronic
1061435744 9:130560617-130560639 GCTGGGCAGACAAACCTCAGGGG + Intergenic
1061715917 9:132518809-132518831 GCAGTGTGGCCGGAGCTCAGAGG - Intronic
1186780390 X:12906148-12906170 GCTTTGCGGCCACAGCCCAGTGG + Intergenic
1190010937 X:46784112-46784134 GCTGTGGGGAGACAGCTCAGAGG - Intergenic
1190329695 X:49228219-49228241 ACTGTGGGCACAGAGCTCAAAGG - Intronic
1190753868 X:53383840-53383862 TCTGTGCTCACAGAGCTCAGGGG + Intronic
1192060141 X:67816378-67816400 GCTGTGCAGCCTGAGCTTAGGGG - Intergenic
1195225645 X:102789783-102789805 GCTGTGCAGACAAAGGTAAGAGG + Intergenic
1195964324 X:110416604-110416626 GCTATGCAGACAGGGCACAGGGG - Intronic