ID: 1088821835

View in Genome Browser
Species Human (GRCh38)
Location 11:113463331-113463353
Sequence CCGTGCCCAATGGCCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088821835_1088821851 29 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821851 11:113463383-113463405 CAGGGACGGGTCCCAGATCTGGG 0: 1
1: 0
2: 2
3: 14
4: 259
1088821835_1088821848 16 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821848 11:113463370-113463392 AAGTGGGCCGTGTCAGGGACGGG 0: 1
1: 0
2: 0
3: 14
4: 135
1088821835_1088821847 15 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821847 11:113463369-113463391 GAAGTGGGCCGTGTCAGGGACGG 0: 1
1: 0
2: 0
3: 25
4: 194
1088821835_1088821846 11 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821846 11:113463365-113463387 GTAGGAAGTGGGCCGTGTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 109
1088821835_1088821850 28 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821850 11:113463382-113463404 TCAGGGACGGGTCCCAGATCTGG 0: 1
1: 0
2: 0
3: 11
4: 110
1088821835_1088821843 -1 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821843 11:113463353-113463375 GGGTTTGGCATGGTAGGAAGTGG 0: 1
1: 0
2: 2
3: 27
4: 263
1088821835_1088821842 -7 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821842 11:113463347-113463369 GGCACGGGGTTTGGCATGGTAGG 0: 1
1: 0
2: 2
3: 8
4: 151
1088821835_1088821844 0 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821844 11:113463354-113463376 GGTTTGGCATGGTAGGAAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 171
1088821835_1088821845 10 Left 1088821835 11:113463331-113463353 CCATCTGTGGCCATTGGGCACGG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1088821845 11:113463364-113463386 GGTAGGAAGTGGGCCGTGTCAGG 0: 1
1: 0
2: 1
3: 4
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088821835 Original CRISPR CCGTGCCCAATGGCCACAGA TGG (reversed) Intronic