ID: 1088821956

View in Genome Browser
Species Human (GRCh38)
Location 11:113464153-113464175
Sequence CTGTAGCTATGGAGAGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088821948_1088821956 17 Left 1088821948 11:113464113-113464135 CCACCCTGTCTTCACCTTTCTTC 0: 1
1: 0
2: 2
3: 78
4: 946
Right 1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG 0: 1
1: 0
2: 0
3: 16
4: 185
1088821951_1088821956 3 Left 1088821951 11:113464127-113464149 CCTTTCTTCTGTTTTTCTTCCAT 0: 1
1: 0
2: 12
3: 236
4: 2220
Right 1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG 0: 1
1: 0
2: 0
3: 16
4: 185
1088821946_1088821956 25 Left 1088821946 11:113464105-113464127 CCCACTTGCCACCCTGTCTTCAC 0: 1
1: 0
2: 1
3: 38
4: 316
Right 1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG 0: 1
1: 0
2: 0
3: 16
4: 185
1088821950_1088821956 13 Left 1088821950 11:113464117-113464139 CCTGTCTTCACCTTTCTTCTGTT 0: 1
1: 0
2: 7
3: 60
4: 779
Right 1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG 0: 1
1: 0
2: 0
3: 16
4: 185
1088821949_1088821956 14 Left 1088821949 11:113464116-113464138 CCCTGTCTTCACCTTTCTTCTGT 0: 1
1: 0
2: 5
3: 90
4: 783
Right 1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG 0: 1
1: 0
2: 0
3: 16
4: 185
1088821947_1088821956 24 Left 1088821947 11:113464106-113464128 CCACTTGCCACCCTGTCTTCACC 0: 1
1: 0
2: 7
3: 86
4: 1201
Right 1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG 0: 1
1: 0
2: 0
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088821956 Original CRISPR CTGTAGCTATGGAGAGGAAT GGG Intronic
902165805 1:14570398-14570420 CTGGGGCTAGGGATAGGAATTGG - Intergenic
903662226 1:24985107-24985129 CTGTAGCTCTGGTGAGGGTTGGG - Intergenic
910546592 1:88425546-88425568 CGGGAGCTAGGGTGAGGAATGGG - Intergenic
914763672 1:150619313-150619335 GTCTAGCTATACAGAGGAATAGG - Intronic
915864307 1:159482171-159482193 CTGTAGCTTTGGGGGGGAAGTGG + Intergenic
916146076 1:161740517-161740539 CTGGAGCTATGGTGAAGAAGTGG - Intergenic
917907088 1:179596078-179596100 CTGTAACTTTGGTGAGGAACTGG - Intronic
919582265 1:199391442-199391464 CTGTACTTAATGAGAGGAATAGG - Intergenic
919725237 1:200878169-200878191 TTGTAGCCATGGAGAGGAGATGG + Intergenic
919924048 1:202183141-202183163 CTGAAGCTGTGGATAGGGATGGG - Intergenic
920047704 1:203144301-203144323 CTGTGGATATAGAGATGAATAGG - Intronic
921729139 1:218557284-218557306 CTGTGTTTATGGAGAGGCATGGG + Intergenic
923428906 1:233901217-233901239 CTGTGACTATGGGGAGGAATGGG + Intergenic
924259927 1:242219324-242219346 GTGTAGGTGTGGAGAGGAAGAGG + Intronic
1065647931 10:27856052-27856074 CTGTAGCAAAGGAGAGTAATGGG - Intronic
1069515176 10:69071744-69071766 CTCTGGCTTTGGAGAAGAATGGG - Intergenic
1069597220 10:69680053-69680075 CTGCAGCAATGGAGAGGCAATGG - Intergenic
1070104544 10:73418770-73418792 CAGTAGGTATGGAGAGCAAGAGG - Intergenic
1070448098 10:76528069-76528091 CTGGTGCTATGGAGTGGATTGGG + Intronic
1072156960 10:92732482-92732504 CTGTAGGTATGAAGAAGAAAGGG - Intergenic
1073351327 10:102822224-102822246 CTGAAGCTATGGTGAGGAACAGG - Intergenic
1073616386 10:105000604-105000626 CTGTAGCTATGAATATGATTTGG - Intronic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1078470575 11:11582868-11582890 CTGTGGCTGTGGTGAGGAGTTGG - Intronic
1081401477 11:42648199-42648221 CAGGAGCTATGCAGAGGAACAGG - Intergenic
1082846097 11:57726791-57726813 CTATACCTATGGAGATAAATTGG + Intronic
1082863533 11:57877272-57877294 CTCTAGCAAGGGAGAGGCATAGG - Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086284668 11:85233189-85233211 CTGTAGCTGGGGACAGAAATAGG - Intronic
1088821956 11:113464153-113464175 CTGTAGCTATGGAGAGGAATGGG + Intronic
1089670479 11:120053506-120053528 CTGCAGCTCTGGAGTTGAATGGG + Intergenic
1094013326 12:25832521-25832543 CAATAGCTATGGAGAAGAAGTGG - Intergenic
1094023490 12:25939306-25939328 CAGGAGCCATGGAGAGGAAAAGG + Intergenic
1096633356 12:52943746-52943768 CTGGAGCTTGGGAGAGGCATGGG - Intronic
1098908218 12:76182766-76182788 CAGGAGCTACAGAGAGGAATAGG - Intergenic
1099652085 12:85441600-85441622 CTATACCTATGCAGATGAATGGG + Intergenic
1108939479 13:55935170-55935192 CTCTAGCTAAGGACAGGACTCGG - Intergenic
1109276898 13:60313557-60313579 CTGTAGATAAGAAGAGAAATTGG + Intergenic
1111598033 13:90435682-90435704 CTGTAGGTAAGGAGCTGAATTGG - Intergenic
1113102069 13:106731981-106732003 CTGTAGTTTGGGAGAGGAAAGGG - Intergenic
1114230913 14:20781820-20781842 CTGTTGCATTGGAGAGGACTTGG - Exonic
1114472959 14:22976312-22976334 CAGTTGCTCTGGGGAGGAATGGG + Intronic
1114567513 14:23643564-23643586 TTTTTCCTATGGAGAGGAATGGG - Intronic
1115898665 14:38119643-38119665 CTTTTGCTAAGGAAAGGAATTGG + Intergenic
1118561521 14:67088936-67088958 ATGTAAATATGGAGAGCAATGGG - Intronic
1119665617 14:76482915-76482937 TTGTAGCATTGGAGAGGAACAGG + Intronic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1126979286 15:54223489-54223511 CTGTAGCTCTGTAGAATAATTGG + Intronic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1135226019 16:20658779-20658801 CTATACCTATGGAGACAAATTGG + Intronic
1136076306 16:27819711-27819733 CTGAAGTTATGATGAGGAATTGG + Intronic
1142317913 16:89360739-89360761 ATGTGGCTATGGAGAGGAAGAGG + Intronic
1144592566 17:16536795-16536817 CTGAAGTTAGGGAGAGGAAAGGG + Intergenic
1145753420 17:27372159-27372181 TTGTAGTAATGGAGAGGTATAGG - Intergenic
1147620178 17:41861259-41861281 CTGTGGTTATAGAAAGGAATAGG - Intronic
1148645816 17:49219297-49219319 CTGTGGCTGTGCAGAGGAAGTGG + Intronic
1149504888 17:57185995-57186017 GAATAGCAATGGAGAGGAATGGG + Intergenic
1151078330 17:71299734-71299756 CTGTAGCTTTGGACTGGAGTTGG + Intergenic
1153136311 18:1921302-1921324 CTATACCTATGGAGAGAAATTGG - Intergenic
1154191447 18:12234219-12234241 CTGAGCCTATCGAGAGGAATGGG - Intergenic
1155611307 18:27670922-27670944 CTGAAGCTAATGAGAGGAAAAGG - Intergenic
1156273621 18:35560369-35560391 TTTTAGCTATGGAAAAGAATTGG + Intergenic
1157225658 18:45861419-45861441 CTGTTGATATGAACAGGAATGGG - Intronic
1161878186 19:6928128-6928150 CAGCAGCTGTGGAGAGAAATAGG - Exonic
1164457926 19:28424146-28424168 CTGTTTCCATGGAGAGGAAGAGG - Intergenic
1165943763 19:39428947-39428969 CTGTAGCTCTGAGGAGGACTGGG - Intergenic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
925673144 2:6333246-6333268 CTGCAGTTATGTAGAGCAATAGG + Intergenic
930889778 2:56370757-56370779 TTGTTACAATGGAGAGGAATTGG + Intronic
932347476 2:71005096-71005118 CTGTAGCTATGCATAGGAGAAGG - Intergenic
933193155 2:79359613-79359635 CTATAGATATGCAGAGGATTAGG + Intronic
933846348 2:86330030-86330052 CTTTAGCTATGGAATGGCATCGG + Intronic
935963419 2:108449134-108449156 CTGTAGCTATGGAGACGTGGGGG + Exonic
936949441 2:117963284-117963306 CTGTTGCTTTAGGGAGGAATGGG - Intronic
937625401 2:124037675-124037697 CTGTAGGTGTGGGGAGGGATGGG + Intronic
937953051 2:127402913-127402935 TTATAGCTATGGAGAGAAACAGG - Intergenic
938045465 2:128115150-128115172 CTCTGGCTATGGCGTGGAATTGG + Exonic
938619579 2:133035273-133035295 TTGCAGCTAAAGAGAGGAATAGG + Intronic
938740049 2:134222505-134222527 CTATACCTATGGAGATAAATTGG - Intronic
940974365 2:159926860-159926882 CTGAAGCTATGGAGAGGAGCAGG + Intergenic
948063055 2:235056104-235056126 CTGGAGGTAGGGGGAGGAATGGG + Intergenic
1168814843 20:729165-729187 CTTTAGATTTGGAGAGGATTTGG + Intergenic
1170282730 20:14669205-14669227 CTGTAACTCTGGAGAGGAGATGG - Intronic
1170427099 20:16246053-16246075 CTCTAGCCCTGGGGAGGAATTGG - Intergenic
1172062494 20:32196150-32196172 CTGGCGCTTTGGAGAGGAAGAGG + Exonic
1173994126 20:47324752-47324774 TGGCAGCTATGGAGAGGACTGGG - Intronic
1174499963 20:50977115-50977137 CTGTGGCTGTGGGAAGGAATAGG + Intergenic
1175083830 20:56443016-56443038 CTGAAGTCATGGGGAGGAATGGG + Intronic
1177491212 21:21828601-21828623 CCTTAGCTATAGAAAGGAATGGG + Intergenic
1178142241 21:29697726-29697748 CTGAAGCTATGGGGAGGAGAAGG - Intronic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1180355802 22:11838526-11838548 CTGTAGCTATGGTGAGGGTGAGG + Intergenic
1180382453 22:12153801-12153823 CTGTAGCTATGGTGAGGGTGAGG - Intergenic
1183863080 22:40683426-40683448 CTGCAGCTCTGAAGAGGAACAGG - Intergenic
1184248369 22:43246927-43246949 CTGAAGCTCTGGAGAGGGAGAGG - Intronic
949173120 3:1026706-1026728 CAGTAGTTATGGCGAGGAGTTGG + Intergenic
949534190 3:4983179-4983201 CAGTGGCTATGGAGGAGAATCGG + Exonic
950040380 3:9916056-9916078 CTGGAGTTCTGGAGAGGAAGTGG - Exonic
950329069 3:12141838-12141860 CTGCTGCTATGTAGAGGACTTGG + Intronic
952433708 3:33250581-33250603 ATGTAGCTATGGACAGAACTAGG + Intergenic
956725085 3:72150418-72150440 CTGGAACTATGGAGGGGAACTGG - Intergenic
960650390 3:119941949-119941971 CACTAGCTCTGGAGAGGAAAGGG - Intronic
963607968 3:147429054-147429076 CTGTAGCTCTCCAGAGGAAGAGG + Intronic
967963807 3:194945018-194945040 TTGTAGCTGGGGAGGGGAATGGG + Intergenic
968734338 4:2287658-2287680 CTGGAGCTAAGGGGAGGAAGGGG + Intronic
968875335 4:3263925-3263947 CTGTCGCTATGGAGTGGCTTTGG + Intronic
969839617 4:9871240-9871262 CTACAGCTATGTAGAGGATTAGG + Intronic
970285803 4:14513153-14513175 GTGTTGCCATGGAGAAGAATTGG - Intergenic
970354947 4:15242715-15242737 CTAGAGCTAGGGAGAAGAATGGG - Intergenic
970491999 4:16584338-16584360 CTGATGATATGGATAGGAATTGG - Intronic
971742603 4:30539707-30539729 CTGCGGCTCTGAAGAGGAATAGG + Intergenic
972272402 4:37523935-37523957 CTGAAGCCCTGGAGAGGATTAGG - Intronic
973873227 4:55187727-55187749 TTGTAGCTAGTGGGAGGAATAGG - Intergenic
977079008 4:92499368-92499390 ATAAATCTATGGAGAGGAATGGG - Intronic
978726696 4:111977632-111977654 CTGCAGCTGTTGTGAGGAATGGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
985139972 4:186829833-186829855 CTGTAGGGATTGAGAGGACTTGG - Intergenic
986443770 5:7803477-7803499 CTGTAGGAAGGAAGAGGAATGGG - Intronic
987213443 5:15708285-15708307 CTTTAGATAGGGAAAGGAATTGG + Intronic
987668899 5:20983175-20983197 CTTTCCCTATGGAGAGCAATGGG - Intergenic
990392145 5:55334735-55334757 CTGTGGCTAGAGATAGGAATGGG - Intronic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
991976051 5:72184555-72184577 CTGTTGCTATGGAGAGTCACTGG + Intronic
993582546 5:89680493-89680515 TTATAGCTAACGAGAGGAATAGG + Intergenic
993743886 5:91572460-91572482 CTATGACTAAGGAGAGGAATTGG - Intergenic
993855731 5:93072371-93072393 CTGTAGCTCTGGAGGGTTATTGG + Intergenic
993886699 5:93423228-93423250 CTGTAGCTAAGGAGAGGCCCCGG - Intergenic
997047791 5:130340183-130340205 CTTTCTATATGGAGAGGAATAGG + Intergenic
997774973 5:136595548-136595570 CTGTGGCCATAGAGATGAATGGG + Intergenic
998546297 5:143030788-143030810 CTATAGCAATGGATATGAATTGG - Intronic
998872028 5:146561926-146561948 TTGTAGTTGTGGGGAGGAATGGG + Intergenic
1002004797 5:176223300-176223322 CTGAACCTATGGGTAGGAATAGG + Intergenic
1002694527 5:181075820-181075842 CTGCATCTATGGAGATGATTTGG - Intergenic
1003538473 6:6997146-6997168 CTGTCGCCATGGAGGGGCATGGG + Intergenic
1004180344 6:13375905-13375927 CTGTAGAGATGGAGATGTATGGG - Intronic
1004741092 6:18461973-18461995 CTAAGGCTATGGACAGGAATAGG - Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1007315518 6:40985455-40985477 CAGTAGTTAGGGAGAGGGATGGG + Intergenic
1011015660 6:82751887-82751909 CAGTTACTATGGAGAGGAATGGG + Intergenic
1011465672 6:87654233-87654255 TTGTAGCTATGGAGAGATATGGG - Intronic
1015392938 6:132702951-132702973 TTGTAGCCATGGGGAGGCATGGG + Intronic
1015764936 6:136706413-136706435 CTGTAGTCATGGTGAGGTATAGG - Intronic
1017094256 6:150790480-150790502 CAGCCCCTATGGAGAGGAATTGG + Intronic
1018172882 6:161155453-161155475 CTGGAGCTGCGGAGAGGCATGGG - Intronic
1018371634 6:163173843-163173865 CTTTGGCTATGGAGAGGACAAGG - Intronic
1020186854 7:5965696-5965718 TTGTAGCTATGAAGGGGAAAAGG - Exonic
1020296062 7:6759078-6759100 TTGTAGCTATGAAGGGGAAAAGG + Exonic
1022004700 7:26256777-26256799 CTATACCTATGGAGATAAATTGG - Intergenic
1022071586 7:26921332-26921354 CTGTACCTTTACAGAGGAATAGG - Intronic
1022725317 7:32976037-32976059 GTGAAGCTATGGAGAGGCATGGG + Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1024690595 7:51797660-51797682 TTGTAGCTATGGAGAAAATTTGG + Intergenic
1025048293 7:55711803-55711825 GTGAAGCTATGGAGAGGCATGGG - Intergenic
1029979073 7:104861480-104861502 CCACAGCTATGGAGAGGACTTGG + Intronic
1031003422 7:116444554-116444576 CGGGAGATATGGAAAGGAATGGG - Intronic
1031875515 7:127135496-127135518 CTGTAGTTAAGGATGGGAATAGG + Intronic
1033512138 7:142069649-142069671 CTGGGGCTGTGGAGAGGACTTGG - Intronic
1033515219 7:142098581-142098603 CTGGGGCTGTGGAGAGGACTTGG - Intronic
1035023207 7:155810600-155810622 CTGTCGGAAGGGAGAGGAATGGG - Intronic
1035343146 7:158177542-158177564 CTGGAGCTGTGGACAGGGATGGG - Intronic
1038546953 8:28433140-28433162 CTGTCCCTATGAAGAGGGATGGG + Intronic
1038701871 8:29856470-29856492 CAGTAGCTTTAGAAAGGAATAGG + Intergenic
1040610175 8:48976367-48976389 CTGGAGCTCTGGAGGGGATTAGG - Intergenic
1040676102 8:49752130-49752152 GTGTAGCTCTGGAAAGAAATGGG - Intergenic
1043701994 8:83300741-83300763 CTGGAACATTGGAGAGGAATTGG + Intergenic
1043948971 8:86286707-86286729 CTGTAGCAATGAAAATGAATAGG - Intronic
1046001631 8:108427248-108427270 CAGGAGCAATGTAGAGGAATGGG - Intronic
1046324033 8:112616934-112616956 CTGAAACTAGGGAGATGAATTGG + Intronic
1048160895 8:132020579-132020601 CTATATCTATAGAGAGGAGTGGG - Intergenic
1048836646 8:138525027-138525049 CTGTAGCTATAAAGATGAGTGGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1050032452 9:1400863-1400885 CTGAAGTTTTGGAGAGGAAGAGG - Intergenic
1050589895 9:7150029-7150051 CTGTAGAAAGGGAGAGGAAGGGG + Intergenic
1052050876 9:23848914-23848936 CTGTTGCCATGGAGAGAACTGGG - Intergenic
1053221512 9:36316946-36316968 ATGGAGCTGTGGAGAGGAATGGG + Intergenic
1053809690 9:41839542-41839564 GTGTAGCTTTGGAGAAGAGTCGG - Intergenic
1054620903 9:67347886-67347908 GTGTAGCTTTGGAGAAGAGTCGG + Intergenic
1054916585 9:70500176-70500198 CTGTGGCCATGAAGAGGAACTGG + Intergenic
1056130207 9:83577525-83577547 TTGTATATATGGTGAGGAATGGG - Intergenic
1056265707 9:84894829-84894851 CTGTAGCTAATTAGAGGAAAAGG - Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056818947 9:89823317-89823339 CTGTAGCCAAGGGGAGGAAGTGG + Intergenic
1058371333 9:104271106-104271128 GTGTGGCTAGGGAGAAGAATGGG + Intergenic
1058753373 9:108061143-108061165 CTGTAGCTTGAGAGAGGATTTGG - Intergenic
1060689977 9:125649169-125649191 TTGTAGGTATGGAGGGGACTAGG - Intronic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1188182397 X:27072531-27072553 GTGTAGCTTTGGAGAGGCGTCGG + Intergenic
1188248598 X:27863886-27863908 CTTTAGATATGGAGAGTACTTGG + Intergenic
1189326381 X:40114238-40114260 CTGTAGTTCTGGTGAGGATTGGG + Intronic
1189362472 X:40363382-40363404 CTGCAGCTAGGGAGACGAAATGG - Intergenic
1189655604 X:43241390-43241412 TTGTAGCTGTAGAGAGGAAGTGG + Intergenic
1190221182 X:48513307-48513329 TTGTAGCTTTGGCCAGGAATGGG + Intronic
1191219506 X:57972724-57972746 TTGTTGATATGGAGAGAAATGGG + Intergenic
1191624796 X:63258888-63258910 CTATATCTATGGAGATAAATTGG - Intergenic
1193061966 X:77216236-77216258 CTGTACTTGTGGAGAGGAAGTGG + Intergenic
1195006421 X:100689995-100690017 CTCTTGGTATGGAGAAGAATAGG - Intronic
1197422369 X:126254252-126254274 CTGCATCTATGGAGATGATTGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1200310714 X:155074117-155074139 CTGCAGCTTTGGATAGGAAGAGG - Intronic
1200418495 Y:2936932-2936954 GTTTAGCTAGGGTGAGGAATGGG + Intronic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic