ID: 1088822770

View in Genome Browser
Species Human (GRCh38)
Location 11:113470636-113470658
Sequence GTATCAGCTTAGTGTAGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088822770_1088822774 16 Left 1088822770 11:113470636-113470658 CCCAAACTACACTAAGCTGATAC 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1088822774 11:113470675-113470697 TTTAACATCAGCCTCTTTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 204
1088822770_1088822773 15 Left 1088822770 11:113470636-113470658 CCCAAACTACACTAAGCTGATAC 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1088822773 11:113470674-113470696 ATTTAACATCAGCCTCTTTCAGG 0: 1
1: 0
2: 1
3: 25
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088822770 Original CRISPR GTATCAGCTTAGTGTAGTTT GGG (reversed) Intronic
901776630 1:11564640-11564662 GTAGCAGCTCAGGGCAGTTTTGG - Intergenic
902498406 1:16891118-16891140 GTATTAGTTTGGTGTACTTTGGG + Intronic
903011320 1:20332676-20332698 GTATCAGCTTAGTGGGGAGTGGG - Intronic
904876826 1:33661826-33661848 GTATCAGCTAAGGGTGGTTGGGG - Intronic
905445042 1:38022199-38022221 GAAGCAGCTTAGTGTAGTAGTGG + Intronic
907141560 1:52190380-52190402 GTTTATGCTTAGTGTACTTTGGG + Intronic
909764352 1:79336906-79336928 TTATCAGTTTAGAGTACTTTAGG + Intergenic
911986727 1:104636041-104636063 GTAACAGCTTTGTTTAGTTTTGG + Intergenic
912107981 1:106304733-106304755 GTATCAGTTTTTTATAGTTTTGG + Intergenic
912242915 1:107929754-107929776 TTATCAGCTTAAAGTAGATTTGG + Intronic
912905923 1:113707126-113707148 GGATAAGCTTAGTGTAGTCATGG + Intronic
912972281 1:114294782-114294804 CTATCATCTTAGTGGACTTTTGG - Intergenic
913049478 1:115104504-115104526 CTAGTAGCTTAGTGAAGTTTAGG + Intergenic
913654851 1:120950902-120950924 GTATTAGTTTGGTGTACTTTGGG - Intergenic
913981180 1:143517666-143517688 GTATCACCTTAATGGATTTTGGG - Intergenic
914006154 1:143734196-143734218 GTATTAGTTTGGTGTACTTTGGG - Intergenic
914645048 1:149645094-149645116 GTATTAGTTTGGTGTACTTTGGG - Intergenic
918869371 1:189948906-189948928 GAATCAGCTTTCTGTATTTTTGG + Intergenic
922634517 1:227153345-227153367 GTTTCAGTTTACTGTAGATTGGG - Intronic
922782691 1:228265377-228265399 GCATCAGCATAGAGTGGTTTTGG + Intronic
1065439928 10:25742012-25742034 GTTTCAGCTTCATGTATTTTGGG - Intergenic
1066211735 10:33246752-33246774 GTATCATTTTAATGTAATTTTGG + Intronic
1066441439 10:35443219-35443241 GTATCAGTTTAGTGTGGCCTAGG - Intronic
1071814393 10:89218028-89218050 GTATAACCTTAGTGTATATTTGG - Intronic
1071850124 10:89559972-89559994 CTTACAGCTTGGTGTAGTTTGGG - Intergenic
1076565722 10:131397723-131397745 GCATCCGTTTGGTGTAGTTTGGG + Intergenic
1079935472 11:26610252-26610274 GTATGATCTTATTGTGGTTTTGG + Intronic
1080737878 11:35035049-35035071 GTAAGAGATTAGTGTAGTTCAGG - Intergenic
1081058207 11:38437972-38437994 GTTTAAGATTAGTGGAGTTTAGG - Intergenic
1085021148 11:73209267-73209289 GCATTAGCTTATTGTATTTTAGG - Intergenic
1087438108 11:98148558-98148580 TTATCAGTTTAGTGTAGCTTAGG - Intergenic
1087728062 11:101745401-101745423 GTTCCATCTTAATGTAGTTTTGG - Intronic
1088822770 11:113470636-113470658 GTATCAGCTTAGTGTAGTTTGGG - Intronic
1088936932 11:114411476-114411498 GTATTATCTTAGTTTGGTTTAGG + Intronic
1089544970 11:119216814-119216836 GTATCTACTGTGTGTAGTTTGGG + Intronic
1091348437 11:134872289-134872311 GTAATGTCTTAGTGTAGTTTTGG + Intergenic
1092395112 12:8119126-8119148 GTATTAGCTTAGTGTTTTTGAGG - Intergenic
1096290854 12:50342018-50342040 GTATTATCTTTGTGAAGTTTTGG - Intronic
1097081882 12:56437954-56437976 GCATTAGTTTGGTGTAGTTTGGG - Intronic
1098477571 12:70922349-70922371 GTTGCAGCTTAGAGTGGTTTGGG - Intergenic
1098604680 12:72375564-72375586 GTATCATTTTAGAGTAGTTCCGG + Intronic
1101308142 12:103551904-103551926 GAATCACCTTAGTCTAGTTAGGG + Intergenic
1102650640 12:114439886-114439908 GTAGCAGCTTAGGGAAGTTCAGG - Intergenic
1103671480 12:122619816-122619838 GTATGAGCATAGAGTACTTTTGG + Intronic
1105271967 13:18885071-18885093 GTATAGGCTTATTGGAGTTTTGG - Intergenic
1105960732 13:25334433-25334455 TTTTTAGCTTAGTGTAGGTTTGG + Intronic
1106270708 13:28150706-28150728 CATTCAGCTTAGTGTAATTTGGG + Intronic
1106817246 13:33422210-33422232 GTATCAGCTTAAGGAGGTTTTGG - Intergenic
1109068333 13:57730556-57730578 TTATCAGCTTGGTGTACTTGAGG - Intergenic
1110323357 13:74185498-74185520 CTACAGGCTTAGTGTAGTTTAGG + Intergenic
1120106370 14:80500101-80500123 ATGTCAGCTTTGTGTAGTTCAGG - Intronic
1120459995 14:84782793-84782815 GTATCAGATTAGTGTGGTATTGG + Intergenic
1121068065 14:90988469-90988491 GAACCATCTTAGTGTAGTATAGG - Intronic
1122863713 14:104594122-104594144 GAATCAGCTTAATGTAGCTCAGG - Intronic
1124511465 15:30330374-30330396 GTGTCAGCTTTGTCTAGTTGTGG + Intergenic
1124731449 15:32200383-32200405 GTGTCAGCTTTGTCTAGTTGTGG - Intergenic
1125037977 15:35149168-35149190 CTTTCAGTTTAGTTTAGTTTTGG - Intergenic
1126835837 15:52664040-52664062 GTTTCAGCTTACTCTAATTTTGG - Intronic
1127789228 15:62383652-62383674 CTATCAGCTTAGTTCAGTTCAGG - Intergenic
1130507727 15:84561752-84561774 GTATAACCTTAGTTTAGATTAGG - Intergenic
1130687240 15:86049268-86049290 GAATACGTTTAGTGTAGTTTGGG + Intergenic
1131612965 15:93984328-93984350 CCATCAGTTTGGTGTAGTTTGGG + Intergenic
1132428058 15:101737036-101737058 GTATAACCTTAGTTTAGATTAGG - Intergenic
1132620213 16:862518-862540 GTATTATCTTTGTGTGGTTTTGG + Intronic
1134632548 16:15767323-15767345 GTACCTGCTTCGTGAAGTTTAGG + Intronic
1135919388 16:26634851-26634873 GTACCACCTGAGTGGAGTTTGGG + Intergenic
1138486486 16:57348288-57348310 GCATCAGCTTGGTGTCATTTGGG - Intergenic
1141415178 16:83865627-83865649 TTATCAGCTTAATGTGTTTTGGG + Intergenic
1143607989 17:8002183-8002205 GTGTCAGCTTGGTGTGGGTTTGG + Intergenic
1144030801 17:11320887-11320909 GTATCATCTGAGTGTAATTCAGG + Intronic
1145011484 17:19370797-19370819 CTATGAGCTGAGTGTGGTTTTGG - Intronic
1147403359 17:40193985-40194007 GAACCAGCAAAGTGTAGTTTTGG - Exonic
1150843217 17:68628799-68628821 GCATCTTCTTAGTGGAGTTTTGG + Intergenic
1156187986 18:34686015-34686037 TTATCAGCTTAATGAAGTTTTGG + Intronic
1156900062 18:42289811-42289833 ATATCAGTTTAGTGATGTTTAGG + Intergenic
925113659 2:1358202-1358224 GTATGATTTTATTGTAGTTTAGG + Intronic
926522336 2:13930948-13930970 CTAACATCATAGTGTAGTTTTGG - Intergenic
927401051 2:22710660-22710682 GTTTTTGCTTAGTGTTGTTTGGG + Intergenic
929534306 2:42770837-42770859 CTATCTGCTTTGTCTAGTTTTGG - Intronic
932788896 2:74634958-74634980 GTACCACCTTAGTCTATTTTGGG + Intronic
933412343 2:81941853-81941875 GTATCAGCTTACAGTATGTTGGG + Intergenic
936107652 2:109639201-109639223 TTATTTGCTTAGTGTAGATTTGG - Intergenic
937841734 2:126531261-126531283 GTATTAGTTTGGTGCAGTTTTGG - Intergenic
938384887 2:130858328-130858350 GTTTCAGCTTCATGTATTTTGGG - Intronic
938385268 2:130861805-130861827 GTTTCAGCTTCATGTATTTTGGG - Intronic
938441947 2:131343359-131343381 TTATCAGCTTAGGGAGGTTTTGG + Intronic
938916002 2:135940774-135940796 GTATCAGCTTAAGGAGGTTTTGG - Intronic
939561311 2:143735494-143735516 GTATCAGCTTAGCGTACTCAGGG + Intronic
940931575 2:159438102-159438124 GTATCTGTTTAATGTATTTTTGG - Intronic
942167058 2:173252277-173252299 GCATCAACTGAGTGTCGTTTAGG + Intronic
944948653 2:204720824-204720846 GTTTCAGCTGAAGGTAGTTTGGG + Intronic
946060677 2:216938536-216938558 GTATCAGCTTGGGTAAGTTTTGG - Intergenic
949011048 2:241678671-241678693 GTTAAAGCTTAGTGTAGTCTAGG + Intronic
1172889723 20:38255411-38255433 GCATCAGCTGAGTGTTGCTTTGG + Intronic
1176589371 21:8628291-8628313 CTTTCAGCTTAGTCTAATTTTGG - Intergenic
1177064206 21:16409480-16409502 GTATCACCTTAGTCTATTCTTGG + Intergenic
1178066849 21:28913924-28913946 GAATCAGCTTTCTGGAGTTTTGG + Intergenic
1180272199 22:10605288-10605310 CTTTCAGCTTAGTCTAATTTTGG - Intergenic
1182381627 22:29894653-29894675 GTATAGGCTTATTGGAGTTTTGG + Intronic
949137934 3:593472-593494 CTTTCAGCTTAGTCTAATTTTGG + Intergenic
949696619 3:6704020-6704042 GTACCAGTATCGTGTAGTTTTGG - Intergenic
950368057 3:12503262-12503284 GTATCAGCATAGTGTTGAGTGGG + Exonic
956627342 3:71279540-71279562 GCATCAGCTTATTTTTGTTTGGG - Intronic
960098977 3:113717990-113718012 GAATCAGCTTGGTATAGTGTGGG - Exonic
966852597 3:184173646-184173668 GTAGCAGTTTAGGGTATTTTTGG + Intronic
972693665 4:41423659-41423681 GTATCTGCTTAGAGGACTTTTGG - Intronic
976539518 4:86257282-86257304 GTACCAGCTTAGGTTAGGTTGGG + Intronic
978727824 4:111991011-111991033 TTCTCAGCTTCGTCTAGTTTAGG - Intergenic
979634460 4:122941510-122941532 TTATCAGCTTAAGGAAGTTTTGG + Intronic
979639769 4:123000181-123000203 TTATCAGCTTAAGGAAGTTTTGG + Intronic
980766775 4:137316812-137316834 ATATCATCTTTGTCTAGTTTTGG + Intergenic
981862575 4:149375260-149375282 ATAGCAGCTGAATGTAGTTTCGG - Intergenic
984101670 4:175494918-175494940 GTATCAGCGTAGTGTTGAGTGGG + Intergenic
984160541 4:176247454-176247476 AAATCAGTTTAGTGTAGTATAGG + Intronic
985991235 5:3563613-3563635 GTTTCAGTTTATTGGAGTTTAGG - Intergenic
987872053 5:23631923-23631945 GTCTCAGCTGAATGTAGCTTTGG + Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993286661 5:86007960-86007982 GTATCAGTATTGTGTTGTTTTGG + Intergenic
1001499036 5:172214151-172214173 GTATCAGCTTATTATAAATTTGG + Intronic
1004392080 6:15218405-15218427 GTATTTGCTTAGAGTAGTTCAGG + Intergenic
1010561249 6:77353378-77353400 GCATCAGCTGAGTTTAGTCTGGG + Intergenic
1021549656 7:21856503-21856525 GTAATGCCTTAGTGTAGTTTTGG - Intronic
1022383167 7:29879615-29879637 TTAGCAGCTTAGAGTAGTCTTGG + Intronic
1025862686 7:65346535-65346557 TTATCAGCTTAATGAATTTTTGG + Intergenic
1027808279 7:82858636-82858658 GTATAAGCTGAGTATAGTATAGG - Intronic
1027924652 7:84445676-84445698 GTTTCAGCTTATAGTATTTTTGG - Intronic
1036166638 8:6440804-6440826 GTATCAGTTAAGGTTAGTTTCGG + Intronic
1042230685 8:66551373-66551395 GTAGCTTCTTTGTGTAGTTTGGG - Intergenic
1042727027 8:71889670-71889692 TTATCAGCTTAACGAAGTTTTGG + Intronic
1042965978 8:74352440-74352462 TTGTCAGCTTCCTGTAGTTTGGG - Intronic
1043300176 8:78718946-78718968 TTATTAGCTTAGTTTAGTTTGGG + Exonic
1044389275 8:91629782-91629804 GAATCAGCACAGTGTATTTTGGG - Intergenic
1046800594 8:118422478-118422500 GTATTAGCTTCGTGAACTTTTGG - Intronic
1052065882 9:24018941-24018963 TTATCAGCTTAAGGAAGTTTTGG + Intergenic
1058819630 9:108717718-108717740 TTATCAGCTTAAGGTAATTTGGG - Intergenic
1060708108 9:125825885-125825907 GTAGTAGCTTTGTTTAGTTTAGG + Intronic
1203619379 Un_KI270749v1:106877-106899 CTTTCAGCTTAGTCTAATTTTGG - Intergenic
1186277822 X:7958932-7958954 GAATCAGATTAGGCTAGTTTTGG + Intergenic
1189889743 X:45588230-45588252 CTTTCTGCTTAGTGTAGCTTTGG + Intergenic
1190402549 X:50052966-50052988 GTTTAAGCTTTGTGTATTTTGGG + Intronic
1190737214 X:53263540-53263562 GGATCAGCTTGCTGTAGTCTAGG - Intronic
1192894504 X:75427147-75427169 ATAACACTTTAGTGTAGTTTAGG - Intronic
1193111294 X:77733341-77733363 CTTTCTGCTTAGTATAGTTTTGG - Intronic
1193886648 X:86990634-86990656 GTAATATCTTTGTGTAGTTTCGG + Intergenic
1197490474 X:127110417-127110439 GTATCAGCTTAAGATACTTTGGG - Intergenic
1199258441 X:145744123-145744145 GCATCAGCTGAGTTTGGTTTGGG - Intergenic
1199974838 X:152887786-152887808 GTGTCAGCTCAGTGTGGTTTGGG - Intergenic
1200235898 X:154467583-154467605 CTATCAGCACAGTGTAGTTGAGG - Exonic