ID: 1088823741

View in Genome Browser
Species Human (GRCh38)
Location 11:113476695-113476717
Sequence GTTTTGTGCCTCTGGAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088823741_1088823750 16 Left 1088823741 11:113476695-113476717 CCCCCTCTCCAGAGGCACAAAAC No data
Right 1088823750 11:113476734-113476756 GCAGCCATCTCTGGAGGCACGGG No data
1088823741_1088823752 24 Left 1088823741 11:113476695-113476717 CCCCCTCTCCAGAGGCACAAAAC No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data
1088823741_1088823749 15 Left 1088823741 11:113476695-113476717 CCCCCTCTCCAGAGGCACAAAAC No data
Right 1088823749 11:113476733-113476755 TGCAGCCATCTCTGGAGGCACGG No data
1088823741_1088823747 7 Left 1088823741 11:113476695-113476717 CCCCCTCTCCAGAGGCACAAAAC No data
Right 1088823747 11:113476725-113476747 CTCTCAAATGCAGCCATCTCTGG No data
1088823741_1088823748 10 Left 1088823741 11:113476695-113476717 CCCCCTCTCCAGAGGCACAAAAC No data
Right 1088823748 11:113476728-113476750 TCAAATGCAGCCATCTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088823741 Original CRISPR GTTTTGTGCCTCTGGAGAGG GGG (reversed) Intergenic
No off target data available for this crispr