ID: 1088823746

View in Genome Browser
Species Human (GRCh38)
Location 11:113476722-113476744
Sequence GAGATGGCTGCATTTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088823746_1088823752 -3 Left 1088823746 11:113476722-113476744 CCTCTCTCAAATGCAGCCATCTC No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data
1088823746_1088823753 6 Left 1088823746 11:113476722-113476744 CCTCTCTCAAATGCAGCCATCTC No data
Right 1088823753 11:113476751-113476773 CACGGGAGCAGAGGAAGCTGTGG No data
1088823746_1088823754 7 Left 1088823746 11:113476722-113476744 CCTCTCTCAAATGCAGCCATCTC No data
Right 1088823754 11:113476752-113476774 ACGGGAGCAGAGGAAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088823746 Original CRISPR GAGATGGCTGCATTTGAGAG AGG (reversed) Intergenic
No off target data available for this crispr