ID: 1088823752

View in Genome Browser
Species Human (GRCh38)
Location 11:113476742-113476764
Sequence CTCTGGAGGCACGGGAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088823742_1088823752 23 Left 1088823742 11:113476696-113476718 CCCCTCTCCAGAGGCACAAAACA No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data
1088823744_1088823752 21 Left 1088823744 11:113476698-113476720 CCTCTCCAGAGGCACAAAACAGC No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data
1088823746_1088823752 -3 Left 1088823746 11:113476722-113476744 CCTCTCTCAAATGCAGCCATCTC No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data
1088823743_1088823752 22 Left 1088823743 11:113476697-113476719 CCCTCTCCAGAGGCACAAAACAG No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data
1088823741_1088823752 24 Left 1088823741 11:113476695-113476717 CCCCCTCTCCAGAGGCACAAAAC No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data
1088823745_1088823752 16 Left 1088823745 11:113476703-113476725 CCAGAGGCACAAAACAGCACCTC No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data
1088823740_1088823752 28 Left 1088823740 11:113476691-113476713 CCGTCCCCCTCTCCAGAGGCACA No data
Right 1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088823752 Original CRISPR CTCTGGAGGCACGGGAGCAG AGG Intergenic
No off target data available for this crispr