ID: 1088827196

View in Genome Browser
Species Human (GRCh38)
Location 11:113506039-113506061
Sequence GTGGTGAAGCTGAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088827196_1088827200 2 Left 1088827196 11:113506039-113506061 CCAGCCTCTTTCAGCTTCACCAC No data
Right 1088827200 11:113506064-113506086 CCCTCTCATCACTTCACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088827196 Original CRISPR GTGGTGAAGCTGAAAGAGGC TGG (reversed) Intergenic
No off target data available for this crispr