ID: 1088830005

View in Genome Browser
Species Human (GRCh38)
Location 11:113528852-113528874
Sequence CTGAGTTAGAGGCAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088830005_1088830010 11 Left 1088830005 11:113528852-113528874 CCTTCCAATTGCCTCTAACTCAG No data
Right 1088830010 11:113528886-113528908 ATCAAATCATAACTCAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088830005 Original CRISPR CTGAGTTAGAGGCAATTGGA AGG (reversed) Intergenic
No off target data available for this crispr