ID: 1088832291

View in Genome Browser
Species Human (GRCh38)
Location 11:113547661-113547683
Sequence CAGTAGGACAAGTGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088832291_1088832299 17 Left 1088832291 11:113547661-113547683 CCACCTTCCCACTTGTCCTACTG No data
Right 1088832299 11:113547701-113547723 CTCTCCATGCTGATGCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088832291 Original CRISPR CAGTAGGACAAGTGGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr