ID: 1088834095

View in Genome Browser
Species Human (GRCh38)
Location 11:113562571-113562593
Sequence CTACTTCAGAACCTCTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088834095_1088834098 -8 Left 1088834095 11:113562571-113562593 CCAAGTAAGAGGTTCTGAAGTAG No data
Right 1088834098 11:113562586-113562608 TGAAGTAGGCTGCAGAGTGTGGG No data
1088834095_1088834100 10 Left 1088834095 11:113562571-113562593 CCAAGTAAGAGGTTCTGAAGTAG No data
Right 1088834100 11:113562604-113562626 GTGGGAGACCAAAGAAGGAAAGG No data
1088834095_1088834099 5 Left 1088834095 11:113562571-113562593 CCAAGTAAGAGGTTCTGAAGTAG No data
Right 1088834099 11:113562599-113562621 AGAGTGTGGGAGACCAAAGAAGG No data
1088834095_1088834097 -9 Left 1088834095 11:113562571-113562593 CCAAGTAAGAGGTTCTGAAGTAG No data
Right 1088834097 11:113562585-113562607 CTGAAGTAGGCTGCAGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088834095 Original CRISPR CTACTTCAGAACCTCTTACT TGG (reversed) Intergenic
No off target data available for this crispr