ID: 1088834904

View in Genome Browser
Species Human (GRCh38)
Location 11:113569249-113569271
Sequence GGACACTCTGTGGGTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088834904_1088834911 25 Left 1088834904 11:113569249-113569271 CCCCAAGGACCCACAGAGTGTCC No data
Right 1088834911 11:113569297-113569319 TTTATTAAATTAATAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088834904 Original CRISPR GGACACTCTGTGGGTCCTTG GGG (reversed) Intergenic
No off target data available for this crispr