ID: 1088840833

View in Genome Browser
Species Human (GRCh38)
Location 11:113626411-113626433
Sequence CTCTAGTTCTGGAGGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088840828_1088840833 16 Left 1088840828 11:113626372-113626394 CCCTGTCTCTAAAAAAATTATAT No data
Right 1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG No data
1088840829_1088840833 15 Left 1088840829 11:113626373-113626395 CCTGTCTCTAAAAAAATTATATA No data
Right 1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088840833 Original CRISPR CTCTAGTTCTGGAGGCTAGA AGG Intergenic
No off target data available for this crispr