ID: 1088841460

View in Genome Browser
Species Human (GRCh38)
Location 11:113630711-113630733
Sequence TGACCAGAAGGCCCATCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088841460_1088841465 16 Left 1088841460 11:113630711-113630733 CCCTAGGATGGGCCTTCTGGTCA No data
Right 1088841465 11:113630750-113630772 AGCTCCTCTTTCTGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088841460 Original CRISPR TGACCAGAAGGCCCATCCTA GGG (reversed) Intergenic
No off target data available for this crispr