ID: 1088842929

View in Genome Browser
Species Human (GRCh38)
Location 11:113641871-113641893
Sequence GACTGATGGCAGGTGTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088842929_1088842933 -6 Left 1088842929 11:113641871-113641893 CCACCTTACACCTGCCATCAGTC No data
Right 1088842933 11:113641888-113641910 TCAGTCCCCACCTTTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088842929 Original CRISPR GACTGATGGCAGGTGTAAGG TGG (reversed) Intergenic
No off target data available for this crispr