ID: 1088844265

View in Genome Browser
Species Human (GRCh38)
Location 11:113651720-113651742
Sequence AAGGTGAGCCTATTAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088844265_1088844270 -3 Left 1088844265 11:113651720-113651742 CCCTTCTCTAATAGGCTCACCTT No data
Right 1088844270 11:113651740-113651762 CTTCTTCAACAAGCCTTCTGGGG No data
1088844265_1088844269 -4 Left 1088844265 11:113651720-113651742 CCCTTCTCTAATAGGCTCACCTT No data
Right 1088844269 11:113651739-113651761 CCTTCTTCAACAAGCCTTCTGGG No data
1088844265_1088844271 6 Left 1088844265 11:113651720-113651742 CCCTTCTCTAATAGGCTCACCTT No data
Right 1088844271 11:113651749-113651771 CAAGCCTTCTGGGGACTTCCTGG No data
1088844265_1088844267 -5 Left 1088844265 11:113651720-113651742 CCCTTCTCTAATAGGCTCACCTT No data
Right 1088844267 11:113651738-113651760 ACCTTCTTCAACAAGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088844265 Original CRISPR AAGGTGAGCCTATTAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr