ID: 1088848160

View in Genome Browser
Species Human (GRCh38)
Location 11:113684683-113684705
Sequence GGGCCTTAATGAGGACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088848160_1088848166 8 Left 1088848160 11:113684683-113684705 CCAGCTGGTCCTCATTAAGGCCC No data
Right 1088848166 11:113684714-113684736 CCGAATCTTCCCAACCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088848160 Original CRISPR GGGCCTTAATGAGGACCAGC TGG (reversed) Intergenic
No off target data available for this crispr