ID: 1088848624

View in Genome Browser
Species Human (GRCh38)
Location 11:113687978-113688000
Sequence CTGTGGTTGCTGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 472}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088848624 Original CRISPR CTGTGGTTGCTGAGGGATGA GGG (reversed) Exonic
901396540 1:8986205-8986227 CTGGGATTGCTCAGGGCTGAAGG - Intergenic
901811171 1:11767403-11767425 CTGTCCCTGCTGGGGGATGAAGG + Intronic
902239717 1:15080449-15080471 CTGTGGCTGCTGGGGGCTGATGG - Intronic
902835663 1:19045216-19045238 CTGAGGGTGCTGAGGGGTGGCGG - Intergenic
903747276 1:25596206-25596228 CTGTGGTTGAATAGGGATGTAGG - Intergenic
904000346 1:27335299-27335321 CTGTGGGTGCTCAGGGCTGCGGG + Intronic
904596587 1:31650125-31650147 CTGTGGATGCTGTGGGAGCAGGG + Intergenic
904609672 1:31718572-31718594 CAGTGGTTGATGGGGGATGGGGG - Intergenic
904636702 1:31887427-31887449 TGGTGGTTGCTAGGGGATGAGGG - Intergenic
904838246 1:33353642-33353664 CTGTGTTTGCTGAGGGGGTAGGG - Intronic
904980191 1:34493975-34493997 CATTGGTTGCTAAGGGATTACGG - Intergenic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
905770007 1:40631322-40631344 CCATGGATACTGAGGGATGACGG - Intronic
905913371 1:41669012-41669034 CTGGAGTTCCTGAGGGATCATGG - Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906339926 1:44970628-44970650 CAGTGTTTGCTAAGGGATGTCGG - Intronic
906713760 1:47951997-47952019 CTGAGGGTGCTGAGCGATGCAGG - Intronic
906806645 1:48785519-48785541 CAGTGGTTGCTAAGGGAAAATGG - Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
907215037 1:52855576-52855598 TTGTGGTTGCTTAGGGCTGGAGG - Intronic
907283036 1:53363179-53363201 CTTGGGTGCCTGAGGGATGAAGG - Intergenic
907681875 1:56571973-56571995 CTGTATTTGCTGAGGAAGGAAGG - Intronic
909706950 1:78596849-78596871 CTGTGATTGGTGAGTGGTGATGG + Intergenic
910154118 1:84193590-84193612 CTGTGATTGGTGAGTGATGGTGG + Intronic
910240143 1:85077660-85077682 TTGGGGTTACTTAGGGATGAAGG + Intronic
910903362 1:92146622-92146644 CAGTGGTTGCTGGGGGTTAATGG - Intronic
910931481 1:92446748-92446770 TGGTGGCTGCTGAGGGAGGAGGG - Intergenic
910973860 1:92885198-92885220 CTGTGGTTGCTCAGGGAATGTGG + Intronic
910978390 1:92932767-92932789 CTGTGGTTGCTAAGGGTTGGAGG + Intronic
911265889 1:95742838-95742860 CTGTGGCTGCTGTGGGATATGGG + Intergenic
911785813 1:101945480-101945502 CAGTGGTTTCTGTGGGAGGAGGG + Intronic
912947379 1:114096287-114096309 CTGGGGGAGCTGAGAGATGAGGG + Intronic
913390171 1:118301950-118301972 TGGTGGTTTCTGAGGGATGAAGG - Intergenic
914218717 1:145658034-145658056 TAGTGGTTGCTAAGGGCTGAGGG - Intronic
914471299 1:147980898-147980920 TAGTGGTTGCTAAGGGCTGAGGG - Intronic
915295725 1:154920217-154920239 CAGTGGTTGCTTGGGGGTGAGGG + Intergenic
915298508 1:154938699-154938721 AAGCGGATGCTGAGGGATGAGGG - Intergenic
917089709 1:171340674-171340696 TTGGGGTTGGGGAGGGATGAAGG + Intronic
917377573 1:174365695-174365717 CGGTGGCTGCTGAGGGATGTGGG + Intronic
917564489 1:176198424-176198446 CTGTGTTTGGTAAGGGTTGAAGG - Intronic
917598086 1:176550014-176550036 CAGTGGTTACTAAGGGCTGAAGG - Intronic
917893996 1:179468872-179468894 TTGTGGTTGCTTAGGGCTGGGGG - Intronic
918443168 1:184588971-184588993 CTGTGGTTGCTAAGTAAGGAAGG - Intronic
919102272 1:193109406-193109428 CTGTTGGGGCTGGGGGATGATGG - Intergenic
919131483 1:193456407-193456429 ATGTGGTTGCTGAAGTCTGAAGG + Intergenic
919867686 1:201794549-201794571 GTGTGGTTTCTGAGGCATTAAGG - Exonic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
919974286 1:202600708-202600730 CTGAGGATGCTGACAGATGAGGG + Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
922144504 1:222926094-222926116 TAGTGGTTGCTGGGGGCTGAGGG - Intronic
922199731 1:223391914-223391936 CTGGGGTTGCTGTGGTCTGAAGG - Intergenic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922885684 1:229018811-229018833 CTGTGGTTGCAAAGGGAGAATGG + Intergenic
923748635 1:236726341-236726363 CTGTTGTTTCTCAGGGATGAGGG + Intronic
924421599 1:243915016-243915038 CTGTGGGGGCTGAGGGACCAAGG - Intergenic
1063156985 10:3389012-3389034 CTGGGGTGGGTGGGGGATGAGGG + Intergenic
1063246837 10:4229244-4229266 CTGTGGTTGTTGAGGAACTATGG - Intergenic
1065510201 10:26470825-26470847 CTGAGGTTGGTGAGAGATGATGG - Intronic
1065510206 10:26470861-26470883 CTGAGGTTGGTGAGAGATTATGG - Intronic
1065807000 10:29403202-29403224 CCGTGGTTGCCAAGGGTTGAGGG + Intergenic
1065938845 10:30545762-30545784 ATGTGGCTGATGAGGAATGAGGG + Intergenic
1066693723 10:38059685-38059707 CAGTGGTTGCTGAGAGTTGAGGG + Exonic
1066999093 10:42589459-42589481 CAGTGGTTGCTGAGAGTTGAGGG - Exonic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1068532368 10:58203935-58203957 CTGTGGCTGCTGATTGATCAGGG - Intronic
1069681170 10:70286480-70286502 ATGTGGCTGCTGAGGAAAGAAGG - Intergenic
1069765008 10:70849677-70849699 CCGTGGTTGTTGAGTGAAGAGGG + Intronic
1069984178 10:72272842-72272864 CAGTGGTTGCTGAGGGTGGGTGG - Intergenic
1070801227 10:79245451-79245473 CAGTGGCTGCTGAATGATGATGG + Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1070920741 10:80184078-80184100 TTGTTGAAGCTGAGGGATGATGG - Intronic
1071219740 10:83451411-83451433 CAGTGGTTGCTTAGGGCTGGGGG + Intergenic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1072613511 10:97034780-97034802 CTCTGCTTGCAGAGGGATGGGGG - Intronic
1072640328 10:97206687-97206709 TTGTGGATGCTGCTGGATGAGGG - Intronic
1073063813 10:100746876-100746898 CTGGAGATGCTGAGAGATGAGGG - Intronic
1074132170 10:110589515-110589537 CAGTGGTTGCAGATGGATGGGGG - Intronic
1075249597 10:120854193-120854215 CAGTGGTTGCCAAAGGATGAGGG - Intronic
1075485169 10:122815756-122815778 ATGTGGTTAATCAGGGATGAAGG - Intergenic
1075502555 10:122989161-122989183 GTGTGGTTGCTTAGAGATGGGGG + Intronic
1075643574 10:124082897-124082919 TTGTGGTTGCTCAAGGCTGAAGG + Intronic
1075675794 10:124294961-124294983 CTGTACTTGCAGAGGCATGATGG - Intergenic
1076303884 10:129449676-129449698 ATGTGGTTGCTGAGGAACCATGG - Intergenic
1077117415 11:891406-891428 CTTTGGTTGCTGTGGGGTGAGGG + Intronic
1077523210 11:3048618-3048640 CTCTGGGTGCTGGGGGATGAGGG + Intronic
1077774795 11:5258847-5258869 CTGTGGCTACTGTGGGAGGATGG - Intronic
1078109599 11:8381988-8382010 CTGTGGTTACAGAGGGATATGGG - Intergenic
1078428634 11:11270566-11270588 CTGTGGTCCCTCAGGAATGAAGG + Intergenic
1078993177 11:16669992-16670014 CTGTGGTAGCTGTGGTATGCTGG - Intronic
1079299114 11:19261523-19261545 CAGTGGTTTCTGAGGGGTGGGGG - Intergenic
1080025813 11:27613696-27613718 CCGTGATTGCAGAGGAATGAGGG - Intergenic
1080829582 11:35878932-35878954 CAGTAGTTGCTGAAGGCTGAGGG - Intergenic
1081665757 11:44916245-44916267 CTGTGGATGCTGAAGAATCAGGG + Intronic
1082998137 11:59268759-59268781 CAGTGGGTGCTGGGTGATGAAGG + Intergenic
1084511333 11:69606177-69606199 GGGTGGTTGCTGATGGATGAAGG - Intergenic
1084722478 11:70916163-70916185 CTGTGAATCCTGAGGGATAAAGG + Intronic
1085044268 11:73344125-73344147 ATGGGGCTGGTGAGGGATGAGGG + Intronic
1085185911 11:74576093-74576115 CAGTGGTTGCTTAGGGCTAAGGG + Intronic
1085258531 11:75191012-75191034 CTGTGGATGCTGAGGAGAGATGG + Intronic
1087050220 11:93879292-93879314 CAGTGGTTGCCTAGGGCTGAGGG - Intergenic
1087793937 11:102435842-102435864 TTGTGGTTGCTTAGGGCTGGTGG + Intronic
1088367444 11:109054283-109054305 CTGTGGTTCCTGAAGGGTTATGG + Intergenic
1088622241 11:111697746-111697768 CTTTGGGTGCTGAGGCAGGAGGG + Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089125767 11:116175488-116175510 CTGAGTTTCCTTAGGGATGAAGG - Intergenic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1093114673 12:15194749-15194771 CTCTGGTTGCTGCAGGATGTTGG + Intronic
1093504989 12:19854765-19854787 CTGTTGTGGGTGGGGGATGAGGG - Intergenic
1095563204 12:43589935-43589957 CTGTAATTGCTATGGGATGAGGG + Intergenic
1097245423 12:57605106-57605128 CTTTGGCTACTGAGGGATGTGGG + Intronic
1098610070 12:72445923-72445945 CACTGGTTGGTTAGGGATGAAGG + Intronic
1101026317 12:100609902-100609924 ATGTGGTTGCTGCTGGAAGATGG + Intronic
1101597906 12:106183493-106183515 CAGTGGTGGCTGGGGGATAAGGG + Intergenic
1101695577 12:107122617-107122639 CTGTGTTTGTTGAGAGATTAGGG - Intergenic
1101821359 12:108186519-108186541 CAGTGGTTGCTGAGGGCTAGAGG - Intronic
1101879839 12:108618657-108618679 CTGGGGGTGCTGATGGAAGAAGG - Intergenic
1102708180 12:114901111-114901133 CTGTCTTTTCTGAGGAATGAGGG - Intergenic
1103167523 12:118783107-118783129 CCGTGTTGTCTGAGGGATGAGGG + Intergenic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104182891 12:126399476-126399498 GTGTGGTGGGTGAGGGATGAGGG - Intergenic
1104894755 12:132158711-132158733 CTGTGAAGGCTGCGGGATGAGGG - Intergenic
1105251883 13:18706718-18706740 CTGTGGATGCTGAGGGACTCTGG - Intergenic
1105401463 13:20099847-20099869 CTGTGGTGGCCTTGGGATGATGG + Intergenic
1105725773 13:23160518-23160540 CTGCGGTCGCTGAGGAAGGACGG + Intergenic
1106180167 13:27363075-27363097 CTGGGGTTGGTGGGGGATGGCGG - Intergenic
1106335764 13:28781762-28781784 CTGATTTTGCTGAGGGATGCTGG + Intergenic
1108058837 13:46512593-46512615 CAGTGGTTGCTTAGGGCTGAGGG - Intergenic
1109199169 13:59411582-59411604 CTATGATTGCTGAGGGTTTATGG + Intergenic
1109438479 13:62337998-62338020 CTCAGGGTGCTGAGAGATGATGG - Intergenic
1110235740 13:73216057-73216079 CTGTGGTTCCTCAAGTATGAAGG - Intergenic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1111789953 13:92842222-92842244 CTGTTATTACTGAGGGATGTTGG + Intronic
1112295004 13:98178702-98178724 CACTGGCTGCTGTGGGATGAGGG + Intronic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1115306220 14:31936643-31936665 CTCTGCAGGCTGAGGGATGATGG - Intergenic
1115925189 14:38425403-38425425 CTCTGCTTGAGGAGGGATGAAGG - Intergenic
1117102668 14:52366433-52366455 ATGTGGTGGCTGAGGGCTCAGGG - Intergenic
1117488135 14:56219476-56219498 CTGTGATAGCTGAGTGCTGAGGG - Intronic
1117867528 14:60165221-60165243 CTGCGCTTCCTGAGGGCTGACGG - Exonic
1117903754 14:60563225-60563247 CTGTGGTTCTTGACAGATGAAGG - Intergenic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1119168586 14:72515773-72515795 CTGCGGTTCCTGAGGGCTCAGGG - Intronic
1121002019 14:90458059-90458081 CTGTGGTAGCTGGGTGATGATGG + Intergenic
1121222793 14:92299171-92299193 CTGTGATTTCTCAGGGATGGTGG + Intergenic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121679990 14:95785818-95785840 TTGTGGATACCGAGGGATGACGG + Intergenic
1122001554 14:98660587-98660609 CAGTGGTTGCCTAGGGATGAGGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122324378 14:100873993-100874015 TTTTGGTTGCTGAGGGCTGGGGG - Intergenic
1122456838 14:101860213-101860235 CAGTGGTTGCTCAGGGCTGGGGG - Intronic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1123123861 14:105930480-105930502 CTGTGTTTCCTTGGGGATGAGGG + Intronic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1125186163 15:36933036-36933058 CTGTGGGTGCTGAGAGAAGGGGG - Intronic
1125712833 15:41800680-41800702 CAGTGGTTGCCTAGGGATGAAGG - Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126842600 15:52731708-52731730 GTGTGATTGCTGGGGGATGGGGG - Intergenic
1127024768 15:54791904-54791926 CAGGGGTTGCTTAGGGATGGGGG + Intergenic
1127133566 15:55895504-55895526 CTGTGGTAGCTGAGGAAAGCTGG + Intronic
1127233661 15:57023827-57023849 CTGTGGATGGTGAGGGTTGTAGG + Intronic
1127561021 15:60136099-60136121 CAGTGGTTTCTCAGTGATGATGG - Intergenic
1127705026 15:61538144-61538166 TAGTGGTTGCTGATGGATCAAGG + Intergenic
1128147169 15:65338078-65338100 CTGTGGCTGCTTAGTGCTGAGGG - Intronic
1128569908 15:68726459-68726481 CCGGGGCTGCTGAGGGAAGAGGG - Exonic
1128690734 15:69723109-69723131 CTGTGGTTGCTGGTTGTTGAGGG + Intergenic
1129195669 15:73964815-73964837 CAGGGGTTGCTGAGAGCTGAGGG - Intergenic
1129465527 15:75722336-75722358 CTGTGGACTCTGAGGCATGAGGG + Intergenic
1129880569 15:79003801-79003823 CTCTGCTTGCTGAGCGCTGAAGG + Exonic
1130937967 15:88486147-88486169 CTATGGGTGATGAGGGGTGATGG + Intergenic
1132257547 15:100389776-100389798 CTGTGGTTGCTGCGGGGTGGGGG + Intergenic
1132577646 16:671373-671395 CTGTGGATGCTGAGGGGTTCAGG - Intronic
1133332549 16:4984162-4984184 GTGGGGGTGTTGAGGGATGAGGG - Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1134263072 16:12669301-12669323 CAGTGGTTGCTAGGGGCTGAGGG + Intronic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134448686 16:14349822-14349844 CTGGGGTGGCTGAGGCAGGAGGG - Intergenic
1135264854 16:21015376-21015398 CAGTGGTTGCTTGGGGATCAGGG + Intronic
1135462995 16:22661305-22661327 CTTTGGCTGCTGTGTGATGATGG - Intergenic
1135726571 16:24858657-24858679 CTGTGGAGGCTGAGGGCTGCTGG - Exonic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1137670256 16:50274438-50274460 CTGTGGTTGGTGGGGGAGGCTGG + Intronic
1137713506 16:50583496-50583518 GTGTGGTTGCAGGGGGAGGAAGG - Intronic
1138428498 16:56952339-56952361 CCGTGGTTCCTGAAGGATTAAGG + Intergenic
1139422192 16:66855718-66855740 CTGGGGGTGCTGAGGAGTGAGGG + Intronic
1139613140 16:68073109-68073131 CTGTGGTGGCTGAAGCAGGAAGG + Intronic
1141055188 16:80807209-80807231 AGGTGCTTCCTGAGGGATGAAGG + Intergenic
1141278483 16:82608882-82608904 CTGTGGTTGTCAGGGGATGAAGG + Intergenic
1141304643 16:82850750-82850772 TGGTGGCTGCTGAGTGATGAGGG - Intronic
1141611356 16:85182811-85182833 CTGTGGATGCTGGGGCAGGAGGG - Intronic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1143021848 17:3921010-3921032 CTGGGGGTGCTGAGGAAAGATGG - Intergenic
1143106681 17:4533731-4533753 CTGTGGTTGCTGCGGATGGAGGG + Intronic
1143266314 17:5640617-5640639 CTGTGGTTGCTGCTGGATGTTGG + Intergenic
1143677874 17:8449564-8449586 CTGTGGTTGCCAGGGGCTGAAGG - Intronic
1143766774 17:9143060-9143082 CTGGAGGTGATGAGGGATGAAGG + Intronic
1144462387 17:15468517-15468539 CTGTGGTTGCAGAGAAGTGAGGG - Intronic
1145096371 17:20031671-20031693 CAGTGGTTGCCAAGGGCTGAGGG - Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1146558674 17:33849400-33849422 CTGTGGAGACTGAGGAATGAGGG + Intronic
1146899434 17:36572844-36572866 TTGTGGTTGCTAGGGGGTGAGGG - Intronic
1148227309 17:45907949-45907971 CTGAGGTTGCAGAGGCAGGAAGG - Intronic
1149272083 17:54990629-54990651 ATGGGGTTGCAGAGGGGTGATGG - Intronic
1150004222 17:61459889-61459911 CAGTGGTTGCTGAAGGAGGGGGG - Intronic
1150673825 17:67226636-67226658 CTGTGGTATCTGAGGGGCGAAGG - Intronic
1150927627 17:69550285-69550307 CAGAGGTGGCTGATGGATGAGGG - Intergenic
1152285261 17:79409009-79409031 TGGTGGTCGCTGAGGGCTGAGGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1153114254 18:1635755-1635777 TGGTGGTTGCTTAGGGATGGTGG - Intergenic
1154127651 18:11706433-11706455 CTGTGGCTGCTGACTGATCAGGG + Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1154951137 18:21210996-21211018 CAGTGGTTGCCAAGGGTTGAGGG - Intergenic
1154977033 18:21468360-21468382 CTGTGATTGCCTAGGGATGGGGG + Intronic
1155206541 18:23563046-23563068 CAGTGGTTGCTTAGGGCTTAGGG - Intronic
1156522124 18:37730759-37730781 CTGATTTTGCTGAGGGGTGATGG - Intergenic
1156810054 18:41237935-41237957 CTGTTGTGGGTGGGGGATGAGGG + Intergenic
1158699814 18:59735662-59735684 CTGAGGTGGCTGATGGATAAAGG + Intergenic
1159454896 18:68648908-68648930 CAGTGGTTACTAGGGGATGAGGG + Intergenic
1159805617 18:72955093-72955115 CTGTGGTTGCCTATAGATGAAGG + Intergenic
1160222954 18:76990471-76990493 CAGGGGATGGTGAGGGATGAGGG + Intronic
1160235604 18:77083823-77083845 CGGTGATTGCTGAGGGCTGTAGG + Intronic
1162925322 19:13928044-13928066 CTGGGGTTGCTGATGGGTGGGGG - Intronic
1163056015 19:14718711-14718733 ACGTGGCTCCTGAGGGATGATGG - Exonic
1163523296 19:17805081-17805103 CTGTGGTCACTAAGGGATTAGGG - Intronic
1163667599 19:18610589-18610611 TGGTGGTTGCTGAGGGTTGTTGG - Intronic
1165652310 19:37502122-37502144 TTGTGGTTGCTGAGACATGCTGG - Intergenic
1165878465 19:39026177-39026199 ATGTGGTTGCTCAGGGAGGAGGG - Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166209707 19:41298435-41298457 CTGTGGTCGCTGGGGGCTGCTGG - Intronic
1167300104 19:48673116-48673138 CTGCGGTTGGTGAGGGATTGGGG - Intergenic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1167419726 19:49395705-49395727 CTGTGGCTGGTGAGGACTGAGGG + Intronic
1168284916 19:55326343-55326365 ATGAGGTTGCTGAAGGATAAAGG + Intronic
1168466851 19:56609461-56609483 GTGTGGTTGCCTAGGGGTGAGGG - Intronic
1168491141 19:56810368-56810390 GTGTGGTTGTTGTGGGATTATGG - Exonic
1202707046 1_KI270713v1_random:31730-31752 CTGTGGCTTCTGACGGAAGAAGG - Intergenic
925144890 2:1574656-1574678 CCAGGGTTGCTGAGAGATGAGGG + Intergenic
925652329 2:6104332-6104354 CTGTGGCTGCTGTGGGGGGATGG + Intergenic
925951641 2:8918923-8918945 CGGTGGTTGCCTAGGGTTGAGGG - Intronic
926174543 2:10578281-10578303 CTGTTCATGCTGTGGGATGATGG - Intronic
929540149 2:42812720-42812742 TTGTGGTTGCTTAGGGCTGGTGG - Intergenic
929883777 2:45860646-45860668 CTGTGGTGGCTGTGGACTGAAGG + Intronic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932097566 2:68865084-68865106 CTGTAGTTGCTCAGAGAGGAGGG - Intergenic
932177703 2:69617962-69617984 CAGAGGTTGCTGAATGATGAAGG - Intronic
932711091 2:74063628-74063650 ATGTGATTGCTAAGGGATGGGGG + Intronic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
936074914 2:109395590-109395612 CTGGGGTTGCTAAGGCATGAGGG + Intronic
937024389 2:118685838-118685860 CTGTGTCTCCTGATGGATGATGG - Intergenic
937149497 2:119676033-119676055 TAGTGGTTGCTAAGGGATGAGGG - Intergenic
937966763 2:127518034-127518056 CAGTGGTTGCTGAGGACTGTGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938942758 2:136183323-136183345 TTGTGTTTGCTGAAGGATGTTGG + Intergenic
939003743 2:136764048-136764070 CTCAGCTTGCTGTGGGATGATGG - Intergenic
940563121 2:155326866-155326888 GTGAGGTTGCTCTGGGATGATGG - Intergenic
941979194 2:171435999-171436021 TAGTGGTTGCTTAGGGCTGAGGG - Intronic
942036009 2:172011250-172011272 TAGTGGTTGCTTAAGGATGAGGG - Intronic
943048732 2:182890296-182890318 CTGGGTTTTCTGAGGGATGCAGG - Intergenic
943312666 2:186345842-186345864 CTGATGTTGATGAGTGATGAAGG - Intergenic
944954925 2:204798186-204798208 CAGCGGCTGCTGGGGGATGAGGG - Intronic
945797450 2:214382597-214382619 CTATTGTTGCTGAGAGAGGATGG - Intronic
946081899 2:217127781-217127803 CTGTGTTTGCTCAGGGAAAATGG + Intergenic
947797296 2:232902456-232902478 CTTGGGTTGCTAAGGGACGAGGG + Intronic
948139143 2:235660078-235660100 CTGTGTGTGCTGAGGGGTGGGGG - Intronic
948281271 2:236749633-236749655 GTGTGCTTGCTGAGGAATAATGG + Intergenic
948971225 2:241428798-241428820 CAGTGGTTGCTGGGGGCTGGCGG - Intronic
1169101168 20:2950970-2950992 CAATGGTTGCTTAAGGATGAGGG - Intronic
1169265657 20:4165851-4165873 CTCTGGTTGCTGAGGGGGCATGG + Intronic
1169436309 20:5595043-5595065 TCGTGGTTGCTGAAGGTTGAAGG - Intronic
1169553725 20:6727607-6727629 CTGTGGCTGATGAGGAATGAGGG + Intergenic
1169575644 20:6957455-6957477 CTGTGATTGCAAAGGGCTGAAGG - Intergenic
1170685762 20:18568075-18568097 GTGTGGTTGCTAGGGGCTGAGGG + Intronic
1171018047 20:21559565-21559587 CGGTGGTTGCCAAGGGCTGAGGG + Intergenic
1172012835 20:31856434-31856456 CGGGGATTGCTGAGGGATGGGGG + Intronic
1172202466 20:33136149-33136171 CTCAGGTTGCTGAGGGATGGAGG - Intergenic
1172594573 20:36141549-36141571 CTGTGGTTGCTGAAAGGTGGGGG + Intronic
1172703245 20:36864977-36864999 CTGCGGTGGCTCAGGGATGGGGG - Intergenic
1172782607 20:37446177-37446199 CTGTGCATGCAGAGGGATGGGGG - Intergenic
1173082581 20:39882994-39883016 CTGTGCCTTCTGAGGCATGAAGG - Intergenic
1173219914 20:41124009-41124031 TTGGGGTTGGGGAGGGATGAAGG + Exonic
1173805653 20:45923437-45923459 CAGTGGTTGCTGGGGGCTGATGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG + Intergenic
1175191295 20:57213730-57213752 CAGTGGGTGCTCAGGGATGTAGG + Intronic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175484808 20:59338271-59338293 TTGGGGTTGTTGAGGGATGTTGG - Intergenic
1175925518 20:62469444-62469466 CTGTGTGTGCTAAGGGGTGATGG - Intronic
1176042946 20:63075097-63075119 CGGTGGGTGCTGAGGCTTGAGGG - Intergenic
1176837412 21:13806601-13806623 CTGTGGATGCTGAGGGACCCTGG - Intergenic
1178121598 21:29475176-29475198 CTGGGGCTGATGAGGAATGAGGG + Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181041244 22:20193695-20193717 GGGAGGGTGCTGAGGGATGACGG - Intergenic
1181100962 22:20538602-20538624 AAGTGGTAGCTGAGGGTTGAAGG - Intronic
1182576302 22:31275375-31275397 CTGTGCTTGCAGAGGGCTCAGGG - Intronic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1183378521 22:37479095-37479117 CCGTGGTTCCTGGGGGATGGAGG + Intronic
1183382822 22:37498888-37498910 CTGTGGGTGCTGGGGGGTGGGGG + Intronic
1184321235 22:43743734-43743756 CTGTGGAGGGTGAGGGGTGAAGG - Intronic
1184992109 22:48177697-48177719 ATGTTGTTGTTGAGGGATGAAGG - Intergenic
1185054788 22:48573979-48574001 CTGTGCCAGGTGAGGGATGAAGG + Intronic
1185086155 22:48742159-48742181 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086170 22:48742202-48742224 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086185 22:48742245-48742267 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185238898 22:49730420-49730442 CGATGGTTGCAGAGGGATGTGGG - Intergenic
949504109 3:4710784-4710806 CTGAGATTTCTGAGGGCTGAGGG - Intronic
950095685 3:10328917-10328939 TTGTTCTTGTTGAGGGATGACGG + Exonic
950847367 3:16027825-16027847 TTGTGTCTGCTGAGGAATGAGGG - Intergenic
951481023 3:23162693-23162715 TTGTGGTTGCTTAGAGCTGAAGG + Intergenic
951884599 3:27511573-27511595 TTGTTGTTGCTGAGGGGTGGTGG + Intergenic
953288491 3:41637209-41637231 TGGTGGTTACTGAGGGGTGAGGG - Intronic
953756261 3:45648259-45648281 CAGTGGTTGCTTAGGGATGAGGG - Intronic
953925965 3:46982497-46982519 GGGTGGCTGCTGAGGGAAGAGGG + Intronic
954372365 3:50175511-50175533 CTCTGGGTGCTGAGTGAGGAAGG - Intronic
954451008 3:50571744-50571766 CTGTAGTTGCTGAGAGGTCAAGG - Exonic
954463987 3:50643973-50643995 CTGAGGTTGCTCAGGGGAGAAGG - Intronic
955817424 3:62860388-62860410 CTGCAGATACTGAGGGATGATGG - Intronic
956399743 3:68864936-68864958 CTGTGGTTGCCTAGGGATGGTGG + Intronic
956956617 3:74348662-74348684 CTGTGGCTGCAGTGGGATGGGGG - Intronic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
960048964 3:113222801-113222823 CTCAGGTTGCTAAGGGAGGAGGG - Intronic
960466089 3:117997726-117997748 CTGTGTTTGCTGAGAGCAGAGGG - Intergenic
961486811 3:127222492-127222514 CTCTGGTTGCAGTGGGGTGAGGG + Intergenic
961565451 3:127760406-127760428 ACGTGGGTGCTGAGGAATGAAGG + Intronic
962375775 3:134857583-134857605 CTGTGGTTGATTGGGGGTGAAGG + Intronic
962417980 3:135201179-135201201 CTGTTGTAGGTGATGGATGATGG + Intronic
963017327 3:140838375-140838397 TTGTGGTTGCCTGGGGATGAGGG + Intergenic
963071818 3:141311168-141311190 CAGTGGATGATGAGGGATCAGGG - Intergenic
963824976 3:149943691-149943713 CAGTGGTTGCTAGGGGATGGGGG - Intronic
963848046 3:150179955-150179977 TTTTGGTTGCTGAGAGAAGAAGG + Intergenic
964672164 3:159238631-159238653 CAGAGGTTGCTGAGGAAGGAGGG + Intronic
964738538 3:159941702-159941724 CTGTGGTTGATGAGGCTTGCAGG - Intergenic
964750696 3:160051291-160051313 TTGTGGTTTTTGAGGGGTGAAGG + Intergenic
964899303 3:161638579-161638601 ATGTGGCTGGAGAGGGATGATGG + Intergenic
964929046 3:161993434-161993456 CTCAGGATGCTGAGGTATGAAGG - Intergenic
966049047 3:175590901-175590923 GTGTGTGTGCTTAGGGATGAAGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967967072 3:194970074-194970096 TAGTGGTTGCTCAGGGCTGAGGG - Intergenic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
969686721 4:8679601-8679623 CTGTGGTGAGTGAGGGGTGAGGG - Intergenic
970352003 4:15210894-15210916 CAGTGCTTGATGAGGGCTGAGGG + Intergenic
970728666 4:19077811-19077833 CAGTGGTTGCTTGGGGATGGAGG - Intergenic
972817700 4:42662165-42662187 TAATGGTTGCTGAGGGATGGGGG + Intergenic
972916452 4:43886496-43886518 CAGTGGTTGCCGGGGGTTGAAGG - Intergenic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
976842888 4:89452380-89452402 CTGTGGTTGCTGGGGTTTGGAGG + Intergenic
977416833 4:96743922-96743944 CTGTGGTTTCTGAGTCAAGAGGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
979703525 4:123694091-123694113 CCTTGGATACTGAGGGATGAGGG + Intergenic
980027861 4:127787443-127787465 ATGTGGTTGGGAAGGGATGAAGG - Intronic
981062443 4:140439443-140439465 CTGTGATTGCTTAGGGATAGAGG - Intergenic
981434961 4:144709526-144709548 CTCTGGTGGCAGAGGGCTGAAGG + Intronic
982120719 4:152140749-152140771 CGGTGGTTGCCTAGGGCTGATGG - Intergenic
982253660 4:153432165-153432187 CTGGGGGTGCTGAGGAAGGAGGG + Intergenic
982349687 4:154401073-154401095 CTGTGGTTGCTTAGGGGCGTGGG - Intronic
982865250 4:160501968-160501990 CTCTGGCTGCTGTGGGAAGAAGG + Intergenic
983704947 4:170645800-170645822 CAGTGGTTGCTGAGGATTGTGGG - Intergenic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
987104893 5:14628897-14628919 TTGTGGTTGCTGGAGGCTGAGGG - Intergenic
987545874 5:19309710-19309732 TTCTGGGTGCTGAAGGATGATGG + Intergenic
987769620 5:22283587-22283609 TTGTGGTTGCTGGGAGCTGAAGG + Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989638160 5:43557300-43557322 CTGGGGGGGATGAGGGATGAGGG + Intronic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990743770 5:58937582-58937604 CTGTGGCTGCTTAGGGCTCAGGG + Intergenic
991519508 5:67480065-67480087 CTTTGGTTGCTCAGGGTGGATGG + Intergenic
991720452 5:69490880-69490902 TAGTGGTTGCCGAGGGATGAGGG + Intergenic
992019534 5:72608077-72608099 TTGTGGGGGCTGAGGGATAAAGG + Intergenic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
994340056 5:98616650-98616672 TTGTGGTTGTTAAGGGCTGAGGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
997263005 5:132478077-132478099 TTGTGGATGCTGAGGGAAGGCGG - Intergenic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
997836465 5:137197314-137197336 CTCTGGGAGATGAGGGATGAGGG + Intronic
998178413 5:139916561-139916583 CAGTGGTTGCCAGGGGATGAAGG - Intronic
998361859 5:141595145-141595167 CTGTGGTTGCCAAGGGTTGGGGG + Intronic
999484861 5:151985334-151985356 CTGTGGTTGCTGTGGGGGGTGGG + Intergenic
1000684089 5:164225100-164225122 CTGTGGTTGCATAGGCATGTTGG - Intergenic
1001250097 5:170140482-170140504 CTGTGGTTGCAGTGGGCTGGAGG - Intergenic
1001398621 5:171433623-171433645 GTGTGGCTGCTGAGGGCTGGGGG + Intronic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1002306350 5:178286190-178286212 CTGGGCCTGGTGAGGGATGAGGG - Intronic
1004989440 6:21120321-21120343 CTGAATTTGCTGTGGGATGATGG - Intronic
1005421126 6:25652207-25652229 CTGGTTTTGCTGAGGGCTGAGGG + Intronic
1006751594 6:36381268-36381290 CTGTGGGGTCTGAGGGATGCCGG + Intronic
1007395693 6:41576411-41576433 CTTTGCTTGTTGAGCGATGATGG + Intronic
1007447029 6:41914753-41914775 GTGTGGATGATGGGGGATGATGG - Intronic
1007599187 6:43071366-43071388 CTGTGGATGGTGAGTGGTGAGGG + Exonic
1007921365 6:45612472-45612494 CAGTGATTGTTTAGGGATGAAGG - Intronic
1007928460 6:45668987-45669009 CTGTGGCTGATGGGGGATGAGGG - Intergenic
1008551131 6:52632185-52632207 TTGTGGTTGCTGAGAGTGGAGGG - Intergenic
1009479854 6:64143145-64143167 CCGTGGTTGCCAAAGGATGATGG + Intronic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011421733 6:87180669-87180691 CTGTGGTTGCTGGGGCTTAAGGG - Intronic
1011457699 6:87569807-87569829 CTGTGGTTGCCAAGGGTTAAGGG + Intronic
1011756622 6:90505777-90505799 CAGTAGTTGCTTGGGGATGAGGG + Intergenic
1013306755 6:108854904-108854926 CAGTGGTTGCTAGGGGATGAGGG - Intronic
1015996093 6:138996684-138996706 CAGTGGTTGCGGGGGGCTGAGGG - Intergenic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1017790469 6:157793678-157793700 CTGGGGTTGCTGAGGCAGGATGG - Intronic
1018176180 6:161181261-161181283 CTGGGATTGCTGAGGGAGGCGGG + Intronic
1018614652 6:165675641-165675663 TTGTTGTTGCTGAGGGATTTTGG + Intronic
1019024032 6:168942464-168942486 CTGTGGTGGATGGGGGATGGTGG + Intergenic
1019062020 6:169263474-169263496 CTGTGGTTGCTGTGTGGGGAGGG - Intergenic
1019382024 7:728750-728772 CACTGGTTGCTGTGGGGTGAGGG + Intronic
1020568299 7:9824697-9824719 CTGTTGGGGGTGAGGGATGAGGG - Intergenic
1021000882 7:15328849-15328871 TTGTGGTTGGAAAGGGATGATGG - Intronic
1022214902 7:28249414-28249436 CTGTGGTTCCTAGGGGTTGAGGG + Intergenic
1022580912 7:31553225-31553247 CTGTGAGTGGTGAGGGATGTGGG + Intronic
1023965272 7:44960853-44960875 CTGAGGGGGCTGAGGGCTGAGGG + Intergenic
1023965401 7:44961251-44961273 CTGAGGGAGCTGAGGGTTGAGGG + Intergenic
1023965553 7:44961674-44961696 CTGAGGGGGCTGAGGGCTGAGGG + Intergenic
1025072804 7:55915699-55915721 CTGTGGTTGGTGTGGAAGGAGGG + Intronic
1025996055 7:66528215-66528237 CTGGGGTTGCAGAGGGATGGGGG + Intergenic
1026987695 7:74565048-74565070 CTCGGGTTGCAGAGGGATGGGGG + Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027820582 7:83038394-83038416 TAGTGGTTGCTTAGGGATGAAGG - Intronic
1028344396 7:89761550-89761572 CTGTGGTTCCTGAGTGGTGCAGG - Intergenic
1028690848 7:93647990-93648012 TTGTGGTTTCTCAGGGCTGACGG + Intronic
1029603373 7:101583185-101583207 CTGGGGTCCCTCAGGGATGAGGG + Intergenic
1030074709 7:105726381-105726403 CTGTGCTGCCTGAGGGATGGGGG - Intronic
1031347531 7:120687254-120687276 CAGTGGTTGCTGGGGGTTAAGGG + Intronic
1031944942 7:127830071-127830093 CTGTGGTTGCTGAATCAAGAAGG + Intronic
1032896873 7:136261195-136261217 CTAGGGTTGCAGAAGGATGAAGG + Intergenic
1033244948 7:139710007-139710029 CTGTTGTTACTCAGGAATGAAGG - Intronic
1033498114 7:141920143-141920165 TAGTGGTTGCTTAGGGCTGAGGG + Intronic
1034452271 7:151143329-151143351 CTGTGGTTGCAGAGAGGAGAAGG + Exonic
1035284987 7:157800088-157800110 CTGTGGTGCCTCAGGGATGGAGG - Intronic
1035318117 7:158010139-158010161 CTGAGCTTGCTGAGGGCTGCTGG - Intronic
1036089770 8:5652982-5653004 ATGTGGGTGGTGAGGAATGATGG + Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037843341 8:22261311-22261333 CTGAGATTGCTGAGGGAAGCAGG - Intergenic
1037889729 8:22617528-22617550 CTGTTGCTTCTGAGGGATGATGG + Exonic
1037967967 8:23148203-23148225 CTCTTGTTGCTGAGGCTTGAGGG - Intronic
1038599297 8:28923190-28923212 CTGCAGTTGCTAGGGGATGAGGG - Intronic
1039442223 8:37603000-37603022 CTGTGGGTGCTGTGGGAGCAAGG - Intergenic
1040878905 8:52182615-52182637 TGGTGGTTGCCGGGGGATGAGGG + Intronic
1041117561 8:54554670-54554692 CTGTGGTTGCCGAGGGAGGGAGG + Intergenic
1042006728 8:64188542-64188564 TAGTGGTTGCTGAGGGTTGGAGG + Intergenic
1043842207 8:85120620-85120642 TTGTGGTTGCTTAGGGTTGAGGG - Intronic
1045482256 8:102601611-102601633 CTGTGGTGGCTGCTGGCTGAGGG - Intergenic
1045845522 8:106630905-106630927 CTGTGCTAGCTGAGGGCAGAAGG + Intronic
1046352650 8:113035468-113035490 CAGTAGTTGCTGAGGGCTGGAGG + Intronic
1046850133 8:118962778-118962800 TAGTGTTTGCTGAGGGCTGAGGG - Intergenic
1047999372 8:130365086-130365108 CTTTAGTTGCTGGGGGATGTAGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049720770 8:144114513-144114535 ATGTGGTTGCTGAGGGCCGGTGG - Intronic
1049791142 8:144473252-144473274 GTGTCGGTGCTGAGGGAAGAAGG - Exonic
1049808253 8:144551194-144551216 CTAGGGTTGCTGGGGGAGGATGG + Intronic
1050186351 9:2979119-2979141 CAGTGGTGGCTGAGGGATGGTGG - Intergenic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050970417 9:11864309-11864331 CTCTGATTGGTGAGTGATGATGG - Intergenic
1051650766 9:19322187-19322209 GGGTTGTTGGTGAGGGATGAAGG + Intronic
1051971552 9:22893791-22893813 CTGGAGTTGATGATGGATGAAGG - Intergenic
1053470575 9:38343413-38343435 CTGAGGATGCAGAGTGATGATGG - Intergenic
1054888491 9:70225402-70225424 GTGTGGGTGCTGGGGGATGCTGG + Intronic
1054971035 9:71087132-71087154 AAGTTCTTGCTGAGGGATGAGGG - Intronic
1055015436 9:71612748-71612770 CAATGGTTGCTAAGGGTTGAGGG + Intergenic
1056701435 9:88914397-88914419 CAGTGGTTGCTAAGGAATGGGGG + Intergenic
1057068425 9:92075618-92075640 CTGTGGCTGCTGTGGCATGCAGG - Intronic
1057157492 9:92856091-92856113 CTGTGTTTTCTGAGGTATGTGGG - Intronic
1058070609 9:100597626-100597648 CTGTGAGGGCTGAAGGATGAAGG - Intergenic
1059670609 9:116488041-116488063 CTGTGATTGATTAGTGATGAAGG + Intronic
1059892735 9:118822153-118822175 TAGTGGTTGCCAAGGGATGAGGG - Intergenic
1060130857 9:121097638-121097660 CTGTTGATGCTATGGGATGATGG + Intronic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060817207 9:126641334-126641356 CTGAGGATGCAGAGAGATGATGG - Intronic
1061257788 9:129462695-129462717 CTGTGGTTGCCTGGGGATGCTGG + Intergenic
1061498282 9:130988039-130988061 CTCTGGTTGCTGGGGCAGGATGG + Intergenic
1062072610 9:134565661-134565683 CTGTGGTCTCTCAGGAATGAGGG + Intergenic
1062529911 9:136995284-136995306 CTGGGGAAGCTGCGGGATGAGGG + Exonic
1062597578 9:137306121-137306143 CTGGGGTTGCTGGGGGCTGAAGG + Intergenic
1062615329 9:137393581-137393603 CAGTGGGTGCTGAGGGCTGTGGG - Intronic
1062695488 9:137873700-137873722 CTGAGGTTGGAGAGGGATGGGGG + Intergenic
1062730437 9:138105422-138105444 CTGTGCTTTCAGAGGGATCAAGG + Intronic
1185714718 X:2331894-2331916 TGGTGGTTGCTGAGGGTAGAGGG - Intronic
1185888097 X:3800875-3800897 TTGTGGTTGCTTAGGGATGGGGG - Intergenic
1186543591 X:10425939-10425961 CTGAGGTTGCTCTGGGAAGAGGG + Intergenic
1186602272 X:11050360-11050382 CAGTTGCTGCTGAGGGATGCGGG + Intergenic
1186626425 X:11298681-11298703 CATTGGTTGCTGGGGGATCACGG - Exonic
1187529115 X:20080638-20080660 CTGTACTTGCTGGGGGATGTGGG - Intronic
1187916040 X:24152652-24152674 CTGTGGTTGTTGAGGTGTTAAGG + Intronic
1187916968 X:24162860-24162882 TAGTGGTTGCTAGGGGATGAAGG - Intronic
1188728784 X:33619782-33619804 GTTTGTTTGCTGAAGGATGAGGG + Intergenic
1189230018 X:39444878-39444900 CTGGGCCTGCTGGGGGATGAGGG + Intergenic
1189252090 X:39608936-39608958 CTGTGTTTGCTGGGGAGTGAGGG + Intergenic
1189852180 X:45188753-45188775 CAGTGGTTGCCAAGGGCTGAGGG - Intronic
1189946082 X:46180309-46180331 CTGTGGCTGCTGTGGGAGTAGGG + Intergenic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1193025331 X:76840503-76840525 CTGTTGTTGGTGAGGCATGGTGG - Intergenic
1194332998 X:92608155-92608177 GTGTGCTTGCTGAGTGATAATGG - Intronic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1195288143 X:103405209-103405231 CTGTGGTTGTTATGGGACGATGG + Intergenic
1195771996 X:108361220-108361242 TTGTGACTGCTAAGGGATGAAGG - Intronic
1195966048 X:110431351-110431373 GTGTGCTGGCTGAGGGATGAAGG + Intronic
1196426491 X:115575015-115575037 CAGTGGTTGCTTAGGGTTGCAGG - Intronic
1196514080 X:116549104-116549126 TTGATGTTGCTGAGGAATGAGGG + Intergenic
1198323004 X:135538039-135538061 CAGTTGTTGCTGAAGGATGGGGG + Intronic
1200063455 X:153494044-153494066 CTGCTCTTGCTGAGGGAAGAAGG + Intronic
1200177421 X:154126556-154126578 CAGTGGTGGCTGTGGGGTGAGGG + Intergenic
1200641690 Y:5727181-5727203 GTGTGCTTGCTGAGTGATAATGG - Intronic
1200941654 Y:8788378-8788400 CTGTGGCTGAAGAGGGATAATGG - Intergenic