ID: 1088849515

View in Genome Browser
Species Human (GRCh38)
Location 11:113693528-113693550
Sequence TGTTTGTTATAAAACTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088849515_1088849520 -3 Left 1088849515 11:113693528-113693550 CCCTCCAAGTTTTATAACAAACA 0: 1
1: 0
2: 1
3: 28
4: 295
Right 1088849520 11:113693548-113693570 ACACATAGAGGGCCTTGTGTTGG 0: 1
1: 0
2: 1
3: 5
4: 116
1088849515_1088849522 12 Left 1088849515 11:113693528-113693550 CCCTCCAAGTTTTATAACAAACA 0: 1
1: 0
2: 1
3: 28
4: 295
Right 1088849522 11:113693563-113693585 TGTGTTGGAAAAACTTCCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088849515 Original CRISPR TGTTTGTTATAAAACTTGGA GGG (reversed) Intronic
906772540 1:48498170-48498192 TATTTGTTATAAAAAAAGGAGGG + Intergenic
907060726 1:51421324-51421346 TGTTTCTCATAATACTTGTAGGG - Intronic
907694394 1:56707294-56707316 TGTTTGTTATGATTGTTGGAAGG + Intronic
908906829 1:69023038-69023060 TGTTTTGAGTAAAACTTGGAAGG - Intergenic
909081076 1:71112479-71112501 TTTTTGGCATATAACTTGGAAGG - Intergenic
909817245 1:80011206-80011228 TGTTTGTTATAAAATTTATTTGG - Intergenic
910668207 1:89746846-89746868 TGTATATCATAAAACATGGATGG - Intronic
911547002 1:99229766-99229788 GATTTTATATAAAACTTGGAGGG - Intergenic
911851040 1:102821191-102821213 TTTTTGTTAGAAAATGTGGAAGG + Intergenic
912104586 1:106256436-106256458 TGTTTATTATAAAACTTTTTTGG - Intergenic
912188069 1:107304518-107304540 TGTTTTTTATAGAATTTAGAAGG - Intronic
912598455 1:110903163-110903185 TGTTTCTAAGTAAACTTGGAAGG + Intergenic
915783900 1:158586344-158586366 TGAATGGTATATAACTTGGATGG - Intergenic
917352819 1:174095583-174095605 AGTTTGTAACAAAATTTGGATGG - Intergenic
918191765 1:182182385-182182407 TGTTTTATATAAAATTTGAAAGG - Intergenic
918394609 1:184100843-184100865 TTTCTGGTATAAAACTTGGCCGG + Intergenic
918681426 1:187359691-187359713 TGTTTATTTTAAAACATGAAAGG - Intergenic
920657391 1:207887063-207887085 TGTTTGTCCTAAAACTTGGGAGG + Exonic
923293414 1:232569464-232569486 TGTTTGTTCAGAAACTTGGGCGG + Intergenic
924244649 1:242072422-242072444 TGATTTTTAAAAAACTTGAAAGG + Intergenic
924323465 1:242872225-242872247 TGTTTGTTTTTAAATGTGGAAGG - Intergenic
924403208 1:243712045-243712067 TGTTTGTTATTAAAGTGAGAGGG - Intronic
1064069545 10:12215206-12215228 TGCTTGTTTTAAAACTTGTCTGG + Intronic
1064332420 10:14406287-14406309 TGTTTACCATAAAGCTTGGAAGG - Intronic
1065145046 10:22760371-22760393 TGGTTTTCATAGAACTTGGAAGG + Intergenic
1065147504 10:22784790-22784812 TGTTTGTTTTAAATCATGAATGG + Intergenic
1067181369 10:43988433-43988455 TGCTTCCTATAAAACTTGGATGG - Intergenic
1067725960 10:48771142-48771164 AGATTGTTTTAAAAATTGGATGG - Intronic
1068246094 10:54371070-54371092 TGAATGTTACAAACCTTGGAAGG + Intronic
1071756178 10:88542810-88542832 TATTTCTTGTAAAACTCGGAGGG - Intronic
1072497445 10:95976126-95976148 TGTTTGTTTTAAAACAAAGAAGG - Intronic
1073349844 10:102811962-102811984 TGTTTTTAATAAGCCTTGGATGG + Intronic
1073718522 10:106138232-106138254 AGTTTTTTATATAACTTCGAAGG - Intergenic
1073770642 10:106731616-106731638 TGTTTGTTATAAATCCTGTAAGG + Intronic
1078971281 11:16414554-16414576 TGTTTTTTTTTAAACTTGCAGGG - Intronic
1079204630 11:18403905-18403927 TTTTTGTTAGAAAACTTGTGTGG + Intronic
1080283367 11:30584277-30584299 TGTTTGTTTTAAATCTAGGGTGG + Intronic
1080284647 11:30595714-30595736 TGTGTGTTAAAACACTTGCAGGG - Intergenic
1080516924 11:33031718-33031740 TGTTTGTTCAAAAACTTCTAGGG + Intronic
1082212173 11:49518510-49518532 TGATTTCTATAAAATTTGGAGGG - Intergenic
1082803721 11:57433033-57433055 TGTTTGCTTTAAGACCTGGAGGG - Intergenic
1082923851 11:58524822-58524844 AGTGTGTGATAGAACTTGGATGG + Intergenic
1083123708 11:60541744-60541766 TTTTTATTATAAAAGTTTGAAGG + Intronic
1085147939 11:74220046-74220068 TGTTTTTTAAAAAATTTGGTGGG - Intronic
1085835663 11:79953746-79953768 TGTGTGGAATAAAACTTGTAGGG + Intergenic
1086637412 11:89106003-89106025 TGATTTCTATAAAATTTGGAGGG + Intergenic
1087896189 11:103589485-103589507 TGTTGGTGATAAATCATGGAGGG + Intergenic
1088849515 11:113693528-113693550 TGTTTGTTATAAAACTTGGAGGG - Intronic
1089971166 11:122694565-122694587 TGTCTCTAAAAAAACTTGGAAGG + Intronic
1090344381 11:126056601-126056623 TGTTTGTTTTAAATTTTGGAAGG - Intronic
1091485520 12:883762-883784 TGTTTGTTGTAGAAATTGGAAGG + Exonic
1092074586 12:5662615-5662637 TGTTTGTTTTTTAACTAGGATGG + Intronic
1093031198 12:14290601-14290623 GGTTTGAGATAAAACTTTGAAGG + Intergenic
1093513552 12:19957793-19957815 TGTTTCTAATTAAACTTGTAAGG + Intergenic
1093849565 12:24019130-24019152 TTTTTTTTCTAAAAGTTGGACGG - Intergenic
1094389098 12:29929623-29929645 TGTTTGGTATAAAAATTTTATGG - Intergenic
1094589627 12:31808337-31808359 TGTTTCTTATTGAACTTAGAAGG - Intergenic
1095916353 12:47483754-47483776 TATTTTTTATATAACTTGGCAGG - Intergenic
1096448697 12:51719030-51719052 TTTTTGGTATATAACTTGGAAGG + Intronic
1099849058 12:88068775-88068797 TATTTGTTATAAAGTTTAGAAGG - Intronic
1100689264 12:97022272-97022294 TGGTTATTCTAAAACTTAGAGGG - Intergenic
1101181138 12:102219291-102219313 AGTTAGTTACAACACTTGGAGGG + Intergenic
1102139180 12:110600532-110600554 TGTTTGGTTTAAAAATTGGTGGG + Intergenic
1102996384 12:117354393-117354415 TGTTTGTTATAAGTCTTAGCTGG - Intronic
1103639303 12:122336317-122336339 TGTTCGATGTATAACTTGGAAGG + Intronic
1106285467 13:28314687-28314709 TGTTTGTTCTAACAGTAGGAAGG - Intronic
1106848585 13:33764058-33764080 AGTTTGTTATATAATCTGGAAGG - Intergenic
1108196401 13:48000270-48000292 TTTTTGTTGTCAAAGTTGGAAGG + Intronic
1108713686 13:53058401-53058423 TGTTTTTCATAAAACTCAGATGG + Intergenic
1108716415 13:53083029-53083051 AGTTTGTTATATAATTTGAATGG + Intergenic
1108761322 13:53569261-53569283 TTTTAGTCATAAAACTTGTAAGG - Intergenic
1108921225 13:55676774-55676796 TGTTGGTTAAAAAACTTAAATGG + Intergenic
1109186813 13:59279494-59279516 TGTCTGTTTTAATACTTGAAAGG + Intergenic
1110050482 13:70890999-70891021 TCTATGTTATAAAATTTGTAGGG + Intergenic
1110222375 13:73087156-73087178 AGATTGTTATAAAAATGGGAAGG + Intergenic
1112919613 13:104595524-104595546 TTAATGTTATAAAACCTGGAAGG + Intergenic
1115431444 14:33323544-33323566 TGTTTCTTATAAAATTTTAATGG + Intronic
1116013876 14:39383169-39383191 TGTTTGTTTTAACACATTGAAGG + Intronic
1116263313 14:42658823-42658845 TAGTTTTTATAAAGCTTGGAAGG - Intergenic
1118124459 14:62885151-62885173 TGTTTTTTAAAAAAATTGGTGGG - Intronic
1118589389 14:67390180-67390202 TGCTTTTTAAAAAACTTTGATGG - Intronic
1118860392 14:69658563-69658585 TCTTTTTAAAAAAACTTGGACGG + Exonic
1120176198 14:81295845-81295867 TATATGTTAGAAAATTTGGAAGG + Intronic
1120520476 14:85522076-85522098 TGTTTTTTAAAAAGCTAGGAAGG - Intergenic
1120864279 14:89282582-89282604 GCTTTGTTATAAAAATTAGATGG - Intronic
1121285017 14:92728374-92728396 TGTTTGTTATAACGCTCAGATGG + Intronic
1122748354 14:103914326-103914348 TGTTTGTAAAAAAATTTGGAGGG - Intronic
1202841273 14_GL000009v2_random:124125-124147 TGTGTGTTATAAAGTTTGAAAGG - Intergenic
1202910662 14_GL000194v1_random:114355-114377 TGTGTGTTATAAAGTTTGAAAGG - Intergenic
1123783713 15:23648086-23648108 TGATTTTTCTAAAACATGGATGG - Intergenic
1126565710 15:50096682-50096704 TGCTTGTTATAAATATTGCAGGG - Intronic
1128333815 15:66773514-66773536 TTTTTGTTATCAAACTTAGAGGG - Intronic
1128864518 15:71104215-71104237 TGTTTTTTATGAAACTTTGCAGG - Intronic
1129762112 15:78135460-78135482 AGTTTATTTTAAAATTTGGAAGG + Intronic
1131542374 15:93285499-93285521 TGTTGATTTTAAAACTTGGAGGG - Intergenic
1131681052 15:94723869-94723891 TGTCGGCTATAAAACTTGAAGGG + Intergenic
1131719359 15:95150428-95150450 TCTTAGTTGCAAAACTTGGAAGG - Intergenic
1131783771 15:95888970-95888992 TGTATTTCATAAAAATTGGAAGG - Intergenic
1131887950 15:96939304-96939326 TTTTTCTTTTAAAATTTGGATGG + Intergenic
1132369713 15:101286780-101286802 AGTTTGTAATAAAAGTGGGAGGG - Intronic
1134402890 16:13926883-13926905 TGTTTGTTATAAAACTGACTAGG - Intronic
1135473994 16:22757365-22757387 TGTTCATTATAAAGCTTGGGAGG - Intergenic
1136999743 16:35217966-35217988 TGTGTGTTATAAAAATTGATAGG - Intergenic
1137017006 16:35387582-35387604 TGTGTGTTATAAAAATTGACAGG + Intergenic
1137019528 16:35410477-35410499 TGTGTGTTATAAAAATTGACAGG + Intergenic
1137032708 16:35538975-35538997 TGTGTGTTATAAAAATTGACAGG + Intergenic
1137429827 16:48409643-48409665 TGTTTCTTATAATCCTAGGAGGG + Intronic
1137918366 16:52457893-52457915 TGTTTTTTACAAAACTTTCATGG - Intronic
1138107137 16:54293813-54293835 GGTTTGTTTAAAAAATTGGAAGG + Intergenic
1139137573 16:64223483-64223505 TGTTTGTTTTAAATCTTAGAAGG - Intergenic
1140883971 16:79226571-79226593 TGTACGTTATAAAAGTTGGTAGG + Intergenic
1141417210 16:83884980-83885002 TGTTTGGTATATACCTTGGAGGG + Intergenic
1144234610 17:13245787-13245809 TCTTTGTTATACAACTAGCAGGG - Intergenic
1145859435 17:28195854-28195876 TTTTTAATATAAAAGTTGGAAGG - Exonic
1149009136 17:51836751-51836773 TGAATGTTATAAAACTGTGATGG + Intronic
1149045906 17:52245021-52245043 TATTTCTTATAAATCTTAGATGG + Intergenic
1149611235 17:57959024-57959046 TGTTATTAATAAAACTTGGCTGG - Intergenic
1152398058 17:80047140-80047162 TGTTTTTTAAAAAACCTGGCCGG - Intronic
1152409407 17:80115110-80115132 TGTTTTTCATCAAACTTGGGCGG + Intergenic
1153229014 18:2919547-2919569 TGTCTGTAATAAAAGTGGGAAGG - Exonic
1153508376 18:5827219-5827241 GATGTGTTCTAAAACTTGGAAGG + Intergenic
1155547032 18:26926536-26926558 TTTTTCCTACAAAACTTGGAAGG - Intronic
1155796761 18:30048372-30048394 TGTCTGTTATTAAAATGGGATGG + Intergenic
1158140970 18:54255264-54255286 TGTTTATTAGAGAACTTTGAGGG + Intergenic
1158695496 18:59699675-59699697 TGTTTGATATCCATCTTGGAAGG + Intergenic
1158775909 18:60579077-60579099 GTTTTCTGATAAAACTTGGATGG + Intergenic
1159285318 18:66342384-66342406 TGTGTGTGATAAGACTTGAATGG + Intergenic
1159762446 18:72445010-72445032 AGTTAGTTTTACAACTTGGATGG - Intergenic
1160619031 18:80157511-80157533 TGTCTGTTATATAACTGGGTCGG - Exonic
1162085543 19:8246859-8246881 TGTTTATTATAAAACATTGGGGG + Intronic
1165398695 19:35583588-35583610 TGTTTGTTTTAAAGATAGGAGGG - Intergenic
1168128925 19:54304935-54304957 TGTCTGAAATAAAAGTTGGAAGG - Intergenic
1202657548 1_KI270708v1_random:37402-37424 TGTGTGTTACAAAGCTTGAAAGG + Intergenic
926397730 2:12461731-12461753 TGTTTTTCATCAAATTTGGAGGG - Intergenic
927727862 2:25441459-25441481 TGGTTGTTATATAACTTGTTTGG + Intronic
928426224 2:31180422-31180444 TGTTTGTTAGAAAAATTGCAGGG + Intronic
929180936 2:39038390-39038412 AGTTTATGATAAAACTTGAATGG + Intronic
930287529 2:49449942-49449964 TGTTTGATATAAATCATCGATGG + Intergenic
930457675 2:51626780-51626802 TGTTTGTTAACAAAATTGTACGG - Intergenic
932901985 2:75711268-75711290 CGTTTGTTTTAAATCTTGGTTGG - Intergenic
935936871 2:108195170-108195192 TGTTTTTTATAAAGATTGAAGGG + Intergenic
937191634 2:120107043-120107065 TGTTATTTATAACACTTGGTTGG + Intronic
937503315 2:122507687-122507709 TGTTTGTTAAAGAAATTGGAAGG + Intergenic
937822683 2:126328492-126328514 TGTTTCTCATAACACTTTGAAGG - Intergenic
939381242 2:141439839-141439861 GGTTTGTTATTAAACTTCTATGG - Intronic
939397761 2:141653020-141653042 TTTATATAATAAAACTTGGAAGG + Intronic
940164087 2:150749393-150749415 AGTATGTTTTAAAACTTGAAAGG - Intergenic
940228257 2:151423020-151423042 TGTTTGTCAAACTACTTGGAAGG + Exonic
940411396 2:153367767-153367789 TGTATGTTGTAAATCTTAGAGGG + Intergenic
941280430 2:163543455-163543477 TTTCTGTTATAAATCTTGCATGG + Intergenic
942064916 2:172261610-172261632 TGTTTGTTTTAAAACTAAAAAGG + Intergenic
943050261 2:182905392-182905414 TCTTTGTTATTAAACTGGGGAGG - Intergenic
943954524 2:194171455-194171477 TCTTTGTTATAAAAATTATACGG + Intergenic
943988418 2:194654385-194654407 TATTTGTGCTAATACTTGGAAGG + Intergenic
943995909 2:194765332-194765354 TTTTTGTTATAAAGATGGGATGG - Intergenic
944746152 2:202658871-202658893 TGTTTCTCATGAAATTTGGAAGG + Intronic
945731487 2:213541681-213541703 TGTTTATTATACATCTTGGAAGG - Intronic
946577889 2:221096074-221096096 TGTTTCTTTTAAAAGATGGAAGG + Intergenic
947197252 2:227581009-227581031 AGTTTATTCTAAAACTTGTATGG - Intergenic
947258364 2:228191581-228191603 TGATAGTCATAAAACTTGAAGGG + Intergenic
947509005 2:230733764-230733786 CATTTGCTCTAAAACTTGGAAGG - Intronic
947512606 2:230771605-230771627 AGTTTGTTCTAAAATTTGAATGG + Intronic
948154969 2:235773979-235774001 TTTTTGTTAAAAATCTTAGAGGG - Intronic
1170287253 20:14723540-14723562 TGTTTCTTAGAAAGCTTGGCTGG + Intronic
1170443543 20:16402198-16402220 TGTTTGGTCTAAGACTTGTATGG - Intronic
1172425721 20:34854688-34854710 CGTGTGTGAGAAAACTTGGAGGG + Intronic
1173450310 20:43157893-43157915 TTTTTGTTGGAAAACTTGGAAGG - Intronic
1176630017 21:9129052-9129074 TGTGTGTTATAAAGTTTGAAAGG - Intergenic
1176678583 21:9804490-9804512 TGTTTGTTACAATAGTTGAAAGG + Intergenic
1177630494 21:23721208-23721230 AGTTTGTCAGAAAACTTGCACGG + Intergenic
1178551094 21:33540281-33540303 TATTTGTTACAAACCTTTGATGG - Intronic
1178962209 21:37075112-37075134 TGTTTGTTTTTAAACTTTAATGG + Intronic
1185054394 22:48570759-48570781 TGTTGGTTTTAAAATTTGAATGG + Intronic
949742185 3:7249139-7249161 TGTTTGGGATAAAACTTCCATGG + Intronic
950486326 3:13276036-13276058 TTTTTGTAATAAAACATTGAGGG + Intergenic
953356441 3:42260147-42260169 TGTTGGTTCCAAAACTGGGAAGG - Intronic
953722189 3:45366126-45366148 GGTTTGTTATAAAGCTTAGATGG + Intergenic
956841147 3:73141448-73141470 AGTTTGTTGTATAACTTAGAAGG + Intergenic
957064156 3:75507496-75507518 TGTTTGTTCTGAAACTTCAATGG + Intergenic
957326145 3:78697476-78697498 TGGTAGTTATAAAAATTGGCTGG - Intronic
957526477 3:81384905-81384927 TTTTTGTTATAAAAACAGGACGG + Intergenic
958122094 3:89304163-89304185 TGCTGGTGATAAAAGTTGGAGGG - Intronic
958558056 3:95705148-95705170 TGTTTGGTTTCAAACTTGCATGG + Intergenic
958791933 3:98661243-98661265 AGTTTATTATCAAAATTGGAAGG + Intergenic
958909139 3:99974030-99974052 TTCTTGTTCTTAAACTTGGAAGG - Intronic
959153834 3:102641839-102641861 TTTTTTCTACAAAACTTGGATGG + Intergenic
959646272 3:108705919-108705941 TGTTTATTTTAAACCTTGTAAGG - Intergenic
960652888 3:119971218-119971240 TTTATGTTTTAAAATTTGGATGG - Intronic
961289197 3:125831889-125831911 TGTTTGTTCTGAAACTTCAATGG - Intergenic
961897893 3:130184143-130184165 TGTTTGTTCTGAAACTTCGATGG + Intergenic
962906621 3:139809229-139809251 TTTTTTTTTTAAAACTTAGATGG + Intergenic
963193383 3:142499036-142499058 TGTTTTTTAAAAAACTTAGCTGG - Intronic
963197577 3:142550419-142550441 AGGTTGTTATAAAAATTGAATGG - Intronic
963272747 3:143301910-143301932 TGTTTTTTATGAAACCAGGAGGG + Intronic
963942996 3:151113976-151113998 TGTTTCTTATAATACTCTGACGG + Intronic
964573923 3:158143194-158143216 TGATTGTTTGAAATCTTGGAGGG + Intronic
966227307 3:177611640-177611662 TGTTTGTTAGAAAGCGTGGTGGG - Intergenic
967784024 3:193470475-193470497 TGTTTTTAAATAAACTTGGAGGG - Intronic
968865413 4:3207498-3207520 TGGTTGTTTTAAAAGTAGGAAGG - Intronic
970063706 4:12066985-12067007 TTCTTGCTATAAAACTTGGAAGG + Intergenic
971051245 4:22865098-22865120 CCTTTGTTATCAAACTTGGGTGG - Intergenic
973291778 4:48477940-48477962 TGATTGTTAGAAAACTGAGATGG - Intergenic
973669706 4:53203752-53203774 TGTTTATTCTAAAATTGGGAGGG + Intronic
975008048 4:69314848-69314870 TGTTTTTTAAAAAAATTTGAAGG - Intronic
975477522 4:74840867-74840889 TGTGTGTTATAAAAATGTGATGG - Intergenic
975792032 4:77963678-77963700 TGTATGTAAAAACACTTGGAGGG - Intergenic
977234236 4:94487791-94487813 TGTTTCTTAAGAAACTTGAAAGG + Intronic
978390582 4:108221114-108221136 TGATAATTATAAAACTTGGGTGG + Intergenic
978557463 4:109996584-109996606 TGTTTCTAATAAAAGTTGGATGG - Intronic
978989175 4:115056636-115056658 AGTTTCTAATAAAAGTTGGATGG - Intronic
979786723 4:124724065-124724087 TGTTTGTTATATGCTTTGGAAGG + Intergenic
980584894 4:134799410-134799432 TGTATGTGTTAGAACTTGGAAGG - Intergenic
980742367 4:136969218-136969240 TGTGTGCTATAAAATTTGGCAGG + Intergenic
981206625 4:142048573-142048595 TGTTTGCTATATGAGTTGGAGGG + Intronic
981426190 4:144606227-144606249 TGTGTGTGATACAACTTGAAGGG - Intergenic
983141284 4:164152677-164152699 TGTTTTTTATCGAACTTGAAAGG - Intronic
983645706 4:169989421-169989443 TGTTTGTTGTAAAGTTTGGATGG + Exonic
984467257 4:180116361-180116383 TCTTTGATTTAAAACTTCGATGG - Intergenic
985396977 4:189554480-189554502 TGTTTGTTACAATAGTTGAAAGG - Intergenic
985804726 5:2034328-2034350 TGCTTGTAATAAAATGTGGAAGG - Intergenic
986767429 5:10940399-10940421 TGTTTGTGATACAAATTGTAAGG - Intergenic
987514369 5:18886978-18887000 TTTTTGTTATAAATCTTAAAAGG + Intergenic
987636654 5:20551465-20551487 TGTGTGTCATAAAATGTGGAAGG - Intronic
987800502 5:22690368-22690390 AGTGTGTAATAAAACTTGGATGG - Intronic
988698786 5:33651464-33651486 TCTTTGTTATTAAACTATGATGG + Intronic
989039179 5:37209168-37209190 TGTTTGTTAGAAAACCTAGTTGG + Intronic
989087109 5:37687278-37687300 TTTTTGATATAAAATTTGGGAGG + Intronic
989176235 5:38529314-38529336 GTTTTGTTTAAAAACTTGGAAGG - Intronic
990972301 5:61522007-61522029 TGGTTGTCCCAAAACTTGGAGGG - Intronic
991448922 5:66731100-66731122 TGTTTATGAAAAAACTTAGATGG + Intronic
992353755 5:75957955-75957977 TATTTGTCAGATAACTTGGAAGG + Intergenic
993740006 5:91527024-91527046 TATTTATTTTAAAACTTTGAAGG - Intergenic
994849202 5:105032550-105032572 TGTCTCTTATTACACTTGGAAGG - Intergenic
995430167 5:112065821-112065843 TGTTTATGATAAAACTGGGGGGG - Intergenic
995447634 5:112263591-112263613 TGCTTGTTATAACATTAGGAAGG - Intronic
996942718 5:129028095-129028117 TGTATATTATAAAACATAGAAGG + Intronic
998587450 5:143442092-143442114 TATTTGTTATAAAACTGGAAAGG + Intergenic
999706102 5:154273586-154273608 TGTTTATTAAAAAATCTGGAGGG + Intronic
1000950271 5:167473246-167473268 TGTTTGTCAAATAATTTGGATGG - Intronic
1001300484 5:170530082-170530104 TGTTTGTCCTAACCCTTGGAGGG + Intronic
1004010111 6:11676902-11676924 TGTTTGGTATTTAACTTGAATGG - Intergenic
1004067003 6:12256706-12256728 TGTTTTTTATAAACCTTGGATGG - Intergenic
1004763418 6:18696782-18696804 TTTTAGTTAAACAACTTGGATGG + Intergenic
1005274959 6:24207140-24207162 TGCATTTTAGAAAACTTGGAAGG + Intronic
1005658602 6:27968895-27968917 AGTTCTTTATAAAAGTTGGAAGG - Intergenic
1005839774 6:29735700-29735722 TGTTTTTCATCAAATTTGGAAGG + Intronic
1008337355 6:50323802-50323824 TGTTAGTTATAAAACTAGAAGGG - Intergenic
1008950365 6:57151557-57151579 TATTAGTTTTAAAACTTTGAGGG - Intronic
1009675219 6:66811326-66811348 TGTTGGATATAAGACTTGAAAGG + Intergenic
1010478002 6:76313177-76313199 TTTTTGTTATGAAATCTGGATGG + Intergenic
1011167679 6:84467850-84467872 TGTTTGTTTTACCACTGGGAAGG + Intergenic
1011400729 6:86958669-86958691 TGTCTGCTATAAAACTCTGAAGG + Intronic
1012188911 6:96256591-96256613 TGTTTGCAATAAAACCTGGCTGG - Intergenic
1012645014 6:101667701-101667723 TTTTTGTTACAAAGCGTGGAAGG + Intronic
1013235114 6:108191376-108191398 TGTTTTTTCTAAATCTTGGAGGG + Intergenic
1013561191 6:111306741-111306763 TGCTTGCTAGTAAACTTGGAAGG - Intronic
1013713655 6:112931801-112931823 TGTTTGCTATAAAAGTGGGCTGG - Intergenic
1014374178 6:120651713-120651735 TAGTTGTTCTAAAAATTGGAAGG + Intergenic
1014607866 6:123500160-123500182 TATTTGTTACAACACTTAGAAGG + Intronic
1015137374 6:129888651-129888673 TCATTGTTATAAAACGTGGGAGG + Intergenic
1015548886 6:134391660-134391682 TGTTTGTTCTAACATTTGGCAGG + Intergenic
1016171338 6:141021527-141021549 TGTATTTTATAAATATTGGAGGG + Intergenic
1017482221 6:154868936-154868958 GGTTTGTTATAAAACTGCAATGG + Intronic
1017683715 6:156890350-156890372 AATTTTTTATAAAACTTAGAAGG - Intronic
1018326360 6:162674206-162674228 TATTTATTTTAAAACTTGGTTGG + Intronic
1018747558 6:166774195-166774217 TTTGTGTTATAAAATTTGGCTGG - Intronic
1020537011 7:9412167-9412189 TGTGTGTTATAACACTTGAGAGG + Intergenic
1020577508 7:9952360-9952382 AGTTTGTTATATATTTTGGAAGG + Intergenic
1020580102 7:9987153-9987175 GGATTGTTATAAAGCTAGGACGG + Intergenic
1021030738 7:15731218-15731240 TGTTTGTTTTAAAATTTATATGG - Intergenic
1022088275 7:27089635-27089657 GTTTTGTTTTTAAACTTGGATGG - Intergenic
1023233665 7:38061139-38061161 TGTGTGTTATAAAATATGAATGG - Intergenic
1023944223 7:44790877-44790899 TGCTTGCTAGAAAACTTGGTTGG + Intergenic
1025005332 7:55349761-55349783 TGTTTTTTATAGAACTTAAAAGG - Intergenic
1025258666 7:57402687-57402709 TGTTGGGTATAAAAATTGGGGGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1026365271 7:69642346-69642368 TGTATGTTAGAAAACTGGGATGG - Intronic
1026416997 7:70192306-70192328 TGTTTCTTATAAAACTTTCTAGG + Intronic
1027146395 7:75698113-75698135 TGATAGTTATAAAACTGGGCTGG - Intronic
1027588979 7:80093738-80093760 TCATTGTTAGAAAACTTGGCCGG + Intergenic
1027935911 7:84602057-84602079 TGTTTATTATATTACTTGGTAGG - Intergenic
1028091297 7:86705900-86705922 AGTTTATTAAAAAATTTGGAAGG + Intronic
1031232478 7:119126312-119126334 TGTTTGTTTTATAAATTGAATGG + Intergenic
1032573291 7:133024849-133024871 AGTTTGTTATAAATTTTGGCAGG - Intronic
1034502933 7:151462722-151462744 TGTTGGGTATAAAAGTTGGGGGG - Intergenic
1034583452 7:152067008-152067030 TGTTTGTTTTACAAATTGAAGGG - Intronic
1035955612 8:4075954-4075976 TCTATGTTTTAAAACTTAGAGGG - Intronic
1036006075 8:4664848-4664870 TGTGTTTTATAAAGTTTGGATGG - Intronic
1041856434 8:62460815-62460837 TGTGTGTTAAAACAATTGGAGGG + Intronic
1042107111 8:65339708-65339730 TGTTTGCTATAAATTTTTGAGGG - Intergenic
1042337782 8:67646716-67646738 TTTTTGAAATAAAACATGGATGG + Intronic
1043104781 8:76094305-76094327 TTTTTGACATGAAACTTGGAGGG - Intergenic
1043469932 8:80552034-80552056 TGTTTGTTTTCTAACTTGTAAGG + Intergenic
1045782004 8:105876424-105876446 TTTTTCTGATGAAACTTGGATGG - Intergenic
1047671660 8:127154476-127154498 TGCATATTATAAAACTTTGATGG - Intergenic
1048246801 8:132812525-132812547 TCTTTGTTACAAAACTGGCAAGG - Intronic
1048405733 8:134118290-134118312 TGATTCTTATAGAAGTTGGATGG + Intergenic
1049488783 8:142880074-142880096 TTTTTGCTATAAACCTTGCAAGG - Intronic
1051004383 9:12325222-12325244 TGGATGTTTTAAAATTTGGATGG - Intergenic
1053336830 9:37282125-37282147 TTTTTGATAGAAAACATGGAGGG - Intronic
1053560846 9:39192582-39192604 TCTTTGTTATAAAAGTGGAAAGG - Intronic
1053824950 9:42012832-42012854 TCTTTGTTATAAAAGTGGAAAGG - Intronic
1054136273 9:61426373-61426395 TCTTTGTTATAAAAGTGGAAAGG + Intergenic
1054605621 9:67174531-67174553 TCTTTGTTATAAAAGTGGAAAGG + Intergenic
1055012819 9:71585784-71585806 ATTTTGTTGAAAAACTTGGAGGG - Intergenic
1055043891 9:71905355-71905377 TCTTTGTAATAATACTTGGTAGG - Intronic
1055127526 9:72735977-72735999 TCTTTGGTATAAAACTTGGTGGG + Intronic
1055144252 9:72913680-72913702 TATTTGTTGGAAAACTTAGATGG + Intronic
1057391967 9:94647832-94647854 CATCTGTTAGAAAACTTGGATGG - Intergenic
1058172736 9:101702374-101702396 TGATTGTTATAAAAGTTGTTTGG - Intronic
1060387165 9:123241606-123241628 TTTTTCTTTTAAAACTTGGTTGG - Intronic
1060596181 9:124850524-124850546 GGTATGTTTTAAAACCTGGAGGG + Intergenic
1060875000 9:127076962-127076984 TGTTTGTTAGAAAAACTGGCCGG + Intronic
1203752853 Un_GL000218v1:96737-96759 TGTGTGTTATAAAGTTTGAAAGG - Intergenic
1203663750 Un_KI270754v1:7025-7047 TGTTTGTTACAATAGTTGAAAGG + Intergenic
1189661541 X:43305320-43305342 TTTTTGGTATATAACTTGGAAGG - Intergenic
1190846333 X:54194967-54194989 TGCTTGATATAAAACTGGCAAGG + Exonic
1192160843 X:68786093-68786115 TGTTTGTTTTAGAACAAGGAAGG - Intergenic
1194464276 X:94213007-94213029 TGTTTGCTAGAATACTTGCAAGG - Intergenic
1195044984 X:101047523-101047545 TGTTTGTTTTAAAAATGAGATGG + Intronic
1195625484 X:107002172-107002194 TGTTTGGTATAAAAGTGGCATGG - Intergenic
1196268266 X:113678965-113678987 TGTTTCTTCTAAAAGTTGTAAGG + Intergenic
1196542511 X:116925637-116925659 TGTTTGTTATAGAAGTTTGCAGG + Intergenic
1197692440 X:129516542-129516564 TATTTGTTAAATAACTTTGAAGG - Intronic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic