ID: 1088853968

View in Genome Browser
Species Human (GRCh38)
Location 11:113729649-113729671
Sequence ACAGCTTACTCACCTTCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088853963_1088853968 6 Left 1088853963 11:113729620-113729642 CCTAGCATTGTCTCCACCCAGAC No data
Right 1088853968 11:113729649-113729671 ACAGCTTACTCACCTTCTTAAGG No data
1088853962_1088853968 7 Left 1088853962 11:113729619-113729641 CCCTAGCATTGTCTCCACCCAGA No data
Right 1088853968 11:113729649-113729671 ACAGCTTACTCACCTTCTTAAGG No data
1088853964_1088853968 -7 Left 1088853964 11:113729633-113729655 CCACCCAGACATCCACACAGCTT No data
Right 1088853968 11:113729649-113729671 ACAGCTTACTCACCTTCTTAAGG No data
1088853965_1088853968 -10 Left 1088853965 11:113729636-113729658 CCCAGACATCCACACAGCTTACT No data
Right 1088853968 11:113729649-113729671 ACAGCTTACTCACCTTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088853968 Original CRISPR ACAGCTTACTCACCTTCTTA AGG Intergenic