ID: 1088858648

View in Genome Browser
Species Human (GRCh38)
Location 11:113779732-113779754
Sequence TGGGTCAGTGACTGGTTAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088858648_1088858654 10 Left 1088858648 11:113779732-113779754 CCTGCTAACCAGTCACTGACCCA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1088858654 11:113779765-113779787 TTTTCTTTCTGCATCTGTGGTGG 0: 1
1: 0
2: 5
3: 56
4: 541
1088858648_1088858656 22 Left 1088858648 11:113779732-113779754 CCTGCTAACCAGTCACTGACCCA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1088858656 11:113779777-113779799 ATCTGTGGTGGGAGTGACTATGG 0: 1
1: 0
2: 1
3: 22
4: 224
1088858648_1088858652 7 Left 1088858648 11:113779732-113779754 CCTGCTAACCAGTCACTGACCCA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1088858652 11:113779762-113779784 TCCTTTTCTTTCTGCATCTGTGG 0: 1
1: 1
2: 3
3: 61
4: 616
1088858648_1088858655 11 Left 1088858648 11:113779732-113779754 CCTGCTAACCAGTCACTGACCCA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1088858655 11:113779766-113779788 TTTCTTTCTGCATCTGTGGTGGG 0: 1
1: 0
2: 1
3: 58
4: 507
1088858648_1088858657 27 Left 1088858648 11:113779732-113779754 CCTGCTAACCAGTCACTGACCCA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1088858657 11:113779782-113779804 TGGTGGGAGTGACTATGGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088858648 Original CRISPR TGGGTCAGTGACTGGTTAGC AGG (reversed) Exonic
900520988 1:3105417-3105439 TGGGCCAGGGGCTGGTCAGCAGG + Intronic
900941900 1:5804278-5804300 TGGGTGAATGACTGGATAGATGG - Intergenic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901632027 1:10652762-10652784 TGGGTCTGTGATTGGGAAGCGGG - Intronic
901738818 1:11329113-11329135 TGGTTCATTGGCTGGTTACCTGG + Intergenic
901782776 1:11605052-11605074 TGGGTCAGTGGGATGTTAGCAGG - Intergenic
904646681 1:31972807-31972829 GGGGTCAGGGAGTGGATAGCAGG + Intergenic
911562145 1:99418706-99418728 TGGATCTGTTACTGGTGAGCTGG - Intergenic
912671499 1:111632191-111632213 TGGGTCATTTAATGGTTAGTAGG + Intronic
920216954 1:204367671-204367693 TGGGTCTGTGATTGGCTAGGAGG - Intronic
920704148 1:208239751-208239773 TGTGTCAGAGACTGGGAAGCAGG - Intronic
921207665 1:212862306-212862328 TGGGGAAGTGACTGTTTAGTAGG - Intronic
921889110 1:220335978-220336000 TGGGTCAGTGAAGGCTGAGCAGG + Intergenic
922059383 1:222073140-222073162 TGGGTCACTCACAGGTTAGGAGG + Intergenic
922210593 1:223483642-223483664 TGGGTCAGTGCCTGCTAGGCGGG - Intergenic
1064584759 10:16828973-16828995 TGGGTATGTGCCTGGATAGCCGG + Exonic
1065896161 10:30164753-30164775 TGGGTCCCTAACTGGTTCGCTGG + Intergenic
1066048250 10:31613036-31613058 TGCCTCAGTGGCTGGTTAGCTGG + Intergenic
1067268652 10:44770445-44770467 TGGGTCACTCACTGGTTGGTTGG - Intergenic
1069295296 10:66836365-66836387 TGAGTCACTGACTCTTTAGCAGG + Intronic
1069735591 10:70652040-70652062 GGAGTCAGTGACTGGGTGGCAGG - Intergenic
1077150208 11:1069751-1069773 TGAGTGAGTGACTGGATAGGTGG - Intergenic
1077150228 11:1069863-1069885 TGGGTTAGTGAATGGATAGGTGG - Intergenic
1077150294 11:1070125-1070147 TGGGTCAGTGGGTGGGTAGATGG - Intergenic
1077312107 11:1893466-1893488 TGGGTTAGTGAATGGATAGGTGG + Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077357810 11:2126848-2126870 TGGGTGAGTGAGTGGTAAGTGGG + Intergenic
1083201312 11:61122711-61122733 TGGGTGGGTGAGTGGGTAGCAGG + Intronic
1084536821 11:69762291-69762313 TGGGTCACTGACTGGATGGCTGG + Intergenic
1088801605 11:113312300-113312322 TGTGTGAGTGAATGGTTAGGTGG + Intergenic
1088858648 11:113779732-113779754 TGGGTCAGTGACTGGTTAGCAGG - Exonic
1091677927 12:2504755-2504777 TGGGTCAGTGTCTCGGGAGCCGG + Intronic
1092237694 12:6820383-6820405 AGGGTCAGTGACTGGTCACTGGG - Exonic
1099097471 12:78392625-78392647 TGGGTAAGTGGCTGTTTACCAGG + Intergenic
1099709887 12:86210281-86210303 TGGGGCAGTCACTGGCTTGCAGG + Intronic
1100334716 12:93618522-93618544 TGGGGCTGAGACTGGTGAGCTGG - Intergenic
1102055392 12:109892860-109892882 AGGTTCAGTAACTGGTAAGCAGG + Intergenic
1103403522 12:120659237-120659259 TGGGGCTGTGACTGCTTCGCGGG - Intronic
1105619379 13:22052331-22052353 TGGGTCAGTGACAACTCAGCTGG + Intergenic
1108871155 13:54988083-54988105 TGGGTCAGGAGCTGGTTAACAGG - Intergenic
1109300905 13:60589183-60589205 TGAGTCAGTTCCTGGTTGGCAGG - Intergenic
1118316983 14:64731540-64731562 TGGGGCAGGGCCTGGTTACCGGG - Exonic
1119322327 14:73739368-73739390 AGGGGCAGTGACTGGTTTGGGGG + Exonic
1124347629 15:28933082-28933104 TGGGTTAGTGACTGAGGAGCAGG - Intronic
1133081030 16:3320382-3320404 TGGGGGAGTGACTGTTTTGCTGG + Intergenic
1133231475 16:4369082-4369104 TGAGTCAGTGGCTGGCTGGCTGG - Intronic
1133530921 16:6654021-6654043 TGGGTCAATGAATGGATAGATGG + Intronic
1134855942 16:17519093-17519115 TGGCACAGTGCCTGCTTAGCAGG + Intergenic
1135981612 16:27152097-27152119 TGGTTCACTCACAGGTTAGCAGG + Intergenic
1136551196 16:30983490-30983512 AGAGTCAGTGCCGGGTTAGCGGG + Intronic
1138192178 16:55022539-55022561 TGGATCCATTACTGGTTAGCTGG - Intergenic
1139189444 16:64844634-64844656 TGGGTCATTCGCTGGCTAGCTGG - Intergenic
1139400810 16:66679954-66679976 GGGGTCAATAACTGGCTAGCTGG - Intronic
1139640270 16:68286641-68286663 TGGATCAGTCATTGTTTAGCAGG + Intronic
1142134588 16:88445837-88445859 TGGCTCCGTGACTGCTTGGCCGG - Intergenic
1143544676 17:7589124-7589146 TGGGTGAGTGCCTGGGAAGCGGG - Exonic
1146313612 17:31790024-31790046 TTGGTCAGAGACTGGTAAGGTGG - Intergenic
1148346022 17:46904177-46904199 TGGATGGGTGGCTGGTTAGCTGG + Intergenic
1148745642 17:49916487-49916509 TGGGTCAATGAATGGATAGATGG - Intergenic
1151414169 17:73950796-73950818 GGAGTCAGGGCCTGGTTAGCAGG + Intergenic
1151414319 17:73951856-73951878 GGAGTCAGGGCCTGGTTAGCAGG - Intergenic
1158562247 18:58524548-58524570 TGGGTGAGTGAATGGTTCGATGG - Intronic
1159868203 18:73730668-73730690 GGAGTCAGTGCCTTGTTAGCTGG - Intergenic
1162453241 19:10767112-10767134 TGGCTCAGTGGCTTGTTGGCTGG + Intronic
1164414593 19:28036007-28036029 GGGGTCAGGGACTGGTGGGCAGG + Intergenic
1165438954 19:35812884-35812906 AGGGGCAGTGACTGATTAACTGG + Exonic
1167101373 19:47406231-47406253 TGGGTGAGTGAGTGGGTAGATGG + Intronic
1167331966 19:48861600-48861622 AGGGTCAGTGGCTGGCTGGCTGG - Exonic
1168319290 19:55499723-55499745 TGGGTGAGTGACTGGAGAGAAGG + Intronic
929054275 2:37862687-37862709 TGGGGCAGTGGCTGCTTAGTGGG + Intergenic
930558789 2:52933350-52933372 TGGTGCAGTGACTGGTTACCTGG - Intergenic
931070070 2:58636907-58636929 TAGGTCAGGGACTGGGTTGCAGG + Intergenic
932635466 2:73384606-73384628 TGGGTCATTGACAGGTAGGCAGG + Intergenic
933851812 2:86373295-86373317 TGGGTCATTTGCTGGCTAGCTGG + Intergenic
934581378 2:95443381-95443403 GGGGTCAGGCTCTGGTTAGCAGG - Intergenic
934598072 2:95633333-95633355 GGGGTCAGGCTCTGGTTAGCAGG + Intergenic
934884752 2:98014576-98014598 TGGGCTAGTGACTGGTGGGCTGG - Intergenic
937159038 2:119742732-119742754 TGGCCAAGTGGCTGGTTAGCTGG - Intergenic
944684509 2:202106159-202106181 GGGGTAAGTAACTGGTGAGCTGG - Intronic
945205207 2:207324211-207324233 TGAGTCAGTGACTAGATAGATGG + Intergenic
948659254 2:239497129-239497151 TGGGGCAGTCACTGATTGGCTGG - Intergenic
1169063069 20:2675538-2675560 TGGGTCAGTAACAAGTTAGTGGG - Intergenic
1169488580 20:6053193-6053215 TGGAGCAGTGACTGTTTACCTGG - Intronic
1172196274 20:33093685-33093707 TGGGTGAGTGAGTGGATAGGTGG - Intronic
1173410775 20:42807796-42807818 TTGCTCAGTGAATGTTTAGCGGG - Intronic
1175089056 20:56486797-56486819 TGGGACTGTGATTGGTTAGTGGG + Intronic
1183064297 22:35352860-35352882 TGGGTCAGAGTCAGGTTGGCAGG + Intergenic
1184321984 22:43748998-43749020 TTTGTCAGTGACTCCTTAGCTGG - Intronic
1184410055 22:44321204-44321226 TGGGTTAGTTACTGGATTGCTGG - Intergenic
1184766828 22:46576710-46576732 TGGGTCAGGGACTGGGCTGCCGG - Intronic
949373073 3:3356016-3356038 TGTGTTAGTGACTGGAAAGCAGG + Intergenic
950073463 3:10170675-10170697 TGGGACAGTGCCTGGCTAGAGGG + Intronic
954127571 3:48540468-48540490 TGGGTCAGTGCCTGGCTGGATGG - Intronic
954519843 3:51215051-51215073 TGGGTAAATGTCTGGTTATCTGG + Intronic
958994595 3:100889285-100889307 TGGGTCTGTCACTGATTATCAGG - Intronic
961905330 3:130257043-130257065 GGGGTCAGTCACGGGTTACCTGG + Intergenic
962715682 3:138124281-138124303 GGGGTCAGTGACTGGGGAGCTGG - Exonic
963003227 3:140702760-140702782 TGGGTCAGCTACTGGTTAAGTGG - Intergenic
963115892 3:141728727-141728749 TGGCACAGTGATTGGTTAACAGG - Intergenic
964747629 3:160026927-160026949 TTGGTCAGTGACTGGCTTACAGG - Intronic
964985316 3:162731664-162731686 TGGGTCAATTGCTGGTGAGCTGG + Intergenic
967990144 3:195124583-195124605 TGGCACAGTGTCTGGTAAGCAGG + Intronic
969473216 4:7402062-7402084 TGGGCCAGTGGATGGTGAGCAGG + Intronic
969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG + Intergenic
973219334 4:47707785-47707807 GGGGTCAGTGTGGGGTTAGCAGG + Intronic
975870941 4:78777018-78777040 TGGGCCAGTGACTCATTAGAGGG + Intronic
981112392 4:140950675-140950697 TGGTTGGTTGACTGGTTAGCTGG - Intronic
985547533 5:517506-517528 TGGATGAGTGAATGGATAGCTGG - Intronic
985837208 5:2280299-2280321 TGGGTGAGTGAGTGGTTGGGTGG + Intergenic
986009163 5:3696600-3696622 TAGGTCAGTGATTGCTTGGCTGG - Intergenic
994069494 5:95584228-95584250 TGTGTCAGTGATTAGTTATCTGG - Intronic
995908710 5:117159352-117159374 TTGGTCTCTGGCTGGTTAGCTGG - Intergenic
998781975 5:145667691-145667713 TGCCTAAGTGACTGGTTAGCAGG - Intronic
999451162 5:151679338-151679360 TGAGTGAGTGACTGGGTGGCAGG + Intronic
1004305050 6:14492942-14492964 TGGGTCCGTTACTGGGCAGCGGG + Intergenic
1007699148 6:43755892-43755914 TGAGTCAGTGAGTGGTTTTCTGG + Intergenic
1008556903 6:52681227-52681249 TGGGATAGGGACTGGGTAGCTGG + Intronic
1008913455 6:56761366-56761388 TGGCTCAGTCACTTGTTAGCTGG - Intronic
1009980931 6:70725025-70725047 TGAGTCAGTGGCTTCTTAGCTGG + Intronic
1017015940 6:150099547-150099569 TGGCTCAGTGTCTGGTAAGATGG - Intergenic
1017300114 6:152847128-152847150 TGGGTCTGTGTTTGGGTAGCAGG - Intergenic
1021022935 7:15626231-15626253 TGGGTCTGTGAGTGATTATCTGG + Intronic
1024942595 7:54777862-54777884 CGGGTCAGTGTCTGGTTGCCAGG - Intergenic
1029201916 7:98844853-98844875 TGGCTCAGTGAGGGGTGAGCAGG + Intergenic
1029623172 7:101702650-101702672 AGGGTTAGTGACTGGCTTGCTGG + Intergenic
1029639510 7:101810778-101810800 GGGGTCAGTGGCTGGTGAGATGG + Intergenic
1031922543 7:127612544-127612566 TGGGTGGGTGACTGGCTGGCTGG + Intronic
1032491950 7:132330413-132330435 TGGATCACTCACTGGTGAGCGGG - Intronic
1034337722 7:150334163-150334185 TGGGTCAGTGGCTTTTTAGATGG - Intronic
1037567604 8:20130663-20130685 TGGGGCAGTGACTGAGGAGCTGG - Intergenic
1037627338 8:20619552-20619574 TGGGGCAGTGACAGGTTCGTTGG + Intergenic
1042591380 8:70402477-70402499 TGGGTCGGTCCCTGGTTAGATGG - Intronic
1043134763 8:76507375-76507397 TGGATCACTCACTGGTTAGCTGG - Intergenic
1048746997 8:137625309-137625331 TAGGCCAGTGTCTGGTTAACTGG + Intergenic
1049007810 8:139866718-139866740 TGGGCCAGTGACTGTTAAGGTGG + Intronic
1049236563 8:141515162-141515184 TGGGTGAGTGAATGGATGGCTGG - Intronic
1052794029 9:32906032-32906054 TCTGTCAGTGACTGGTCACCAGG + Intergenic
1055056616 9:72029981-72030003 TGGGTGAGTGGTTGGTTGGCTGG - Intergenic
1058177927 9:101759793-101759815 TGGGTCAGTGACTGTTAGGGAGG - Intergenic
1061846943 9:133393293-133393315 TGGGTCAGTGGATGGATAGATGG + Intronic
1062591227 9:137275692-137275714 TGGGTGAGGGACTGGTGAGGTGG + Intergenic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1062649785 9:137569599-137569621 TGGGTGAGTGGCTGGCTGGCTGG - Intronic
1062701857 9:137910614-137910636 TGGGTCAGTGACAGATCATCAGG + Intronic
1203771354 EBV:51479-51501 TGGGGCACGGACTGGTCAGCGGG - Intergenic
1185639334 X:1578045-1578067 TGGGTGGGTGAGTGGTTAGATGG + Intergenic
1186400294 X:9252242-9252264 TGGGTAAGTAAGTGTTTAGCAGG + Intergenic
1191965463 X:66752580-66752602 TAGCTCAGGGACTGGTTTGCTGG + Intergenic
1199453742 X:148003643-148003665 TGGGTCAGTGACTGAATTTCAGG - Intronic