ID: 1088859244

View in Genome Browser
Species Human (GRCh38)
Location 11:113784463-113784485
Sequence TTGTTAGCCACCTGCTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088859242_1088859244 -7 Left 1088859242 11:113784447-113784469 CCTAAAACTGCCACTGTTGTTAG No data
Right 1088859244 11:113784463-113784485 TTGTTAGCCACCTGCTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088859244 Original CRISPR TTGTTAGCCACCTGCTTTGA AGG Intergenic
No off target data available for this crispr