ID: 1088861405

View in Genome Browser
Species Human (GRCh38)
Location 11:113803216-113803238
Sequence AATGCTGCCCTGCTGATGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088861405_1088861412 17 Left 1088861405 11:113803216-113803238 CCCTTCATCAGCAGGGCAGCATT 0: 1
1: 0
2: 1
3: 21
4: 186
Right 1088861412 11:113803256-113803278 CCAGGTAGGAAAGTGCCTCTTGG 0: 1
1: 0
2: 0
3: 15
4: 170
1088861405_1088861410 3 Left 1088861405 11:113803216-113803238 CCCTTCATCAGCAGGGCAGCATT 0: 1
1: 0
2: 1
3: 21
4: 186
Right 1088861410 11:113803242-113803264 CTGGTAGGCATATACCAGGTAGG 0: 1
1: 0
2: 0
3: 10
4: 76
1088861405_1088861409 -1 Left 1088861405 11:113803216-113803238 CCCTTCATCAGCAGGGCAGCATT 0: 1
1: 0
2: 1
3: 21
4: 186
Right 1088861409 11:113803238-113803260 TGCTCTGGTAGGCATATACCAGG 0: 1
1: 0
2: 0
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088861405 Original CRISPR AATGCTGCCCTGCTGATGAA GGG (reversed) Exonic
900940599 1:5796168-5796190 GATTCAGCCCTGCTGATGACTGG - Intergenic
901151157 1:7102760-7102782 GATGCTGCCCTTCTGATGCTGGG + Intronic
901239376 1:7684109-7684131 AATGGTGCCCTGCGGAGAAATGG + Intronic
912195973 1:107397276-107397298 ATTTCTGCCATGCTGATGATTGG - Intronic
915204997 1:154263549-154263571 AATGCTGTGCTGTGGATGAAGGG + Intronic
917993815 1:180412918-180412940 AATGCTGGCCTACTAATTAAAGG - Intronic
918164839 1:181935314-181935336 AAAGCTGGCCTGGTGATGACAGG - Intergenic
919485530 1:198142256-198142278 GATGCTGTCATGGTGATGAATGG + Intergenic
921683038 1:218056634-218056656 AATGTTCCTCAGCTGATGAATGG - Intergenic
921908872 1:220527224-220527246 AATGCAGCCTTGCTTATAAAAGG + Intergenic
922025578 1:221745155-221745177 AAAGATCCCCTGCTGATAAAAGG + Intergenic
922251613 1:223854379-223854401 AGTGCTCCCCTTCTGATGATTGG + Intergenic
924556735 1:245125118-245125140 AATGCTCATCAGCTGATGAAGGG - Intronic
1067354884 10:45514924-45514946 AATACTGACCTGCTGATCACAGG - Intronic
1068669941 10:59712114-59712136 AATGCTCCCCTGCAGATGATGGG - Intronic
1070954773 10:80456357-80456379 ACAGCTGCCCAGCTGGTGAAGGG - Intronic
1072915261 10:99533743-99533765 ACTGCTGCCCTGATGCTGAGAGG + Intronic
1075407733 10:122205697-122205719 AGTGCTGCTCTGCAGAGGAAGGG + Intronic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1078199766 11:9170329-9170351 AATGCTAGCTTGCTGTTGAATGG + Intronic
1078721641 11:13889963-13889985 TGTGCTGCCCTGCAGATTAATGG + Intergenic
1081545878 11:44071242-44071264 AATGATGCCCTGGAGATGAGAGG - Exonic
1083772758 11:64877765-64877787 ACTGCGGCCCTGCTGCTGAGGGG + Intronic
1084345827 11:68548213-68548235 AATTCTGACCTGCTGTTGACTGG + Intronic
1084428084 11:69096493-69096515 AAGGCTGCCTGGCTGGTGAATGG + Intergenic
1087016755 11:93561518-93561540 AATGCTGATCAGCTGATGAATGG - Intergenic
1088692495 11:112339623-112339645 CAGGCTGCCCTGCTGTTGGAAGG + Intergenic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1089290776 11:117436973-117436995 AATGCTGGCCTGCAGGTGAAGGG - Intronic
1090110199 11:123899297-123899319 AAGGCAGCCCAGCTGATAAACGG - Intergenic
1090561073 11:127933230-127933252 AATGCTGTCCTTCTGTGGAAAGG - Intergenic
1091694950 12:2622220-2622242 AATGCTGCCCTGCTGTCCAGAGG + Intronic
1091983474 12:4886225-4886247 AAAGTTGCCCTGATGCTGAAGGG + Intergenic
1092749584 12:11706195-11706217 AAAGCTGCACTGCAAATGAAAGG - Intronic
1093646401 12:21590166-21590188 ATTGTTGCCCTGCTCTTGAAGGG - Intronic
1100213429 12:92422329-92422351 GATAGTGTCCTGCTGATGAATGG + Intronic
1100325943 12:93540033-93540055 GATGCTCCCCTTCTGATGACCGG - Intergenic
1102003988 12:109577198-109577220 AAAGCTGGCCTGCTTATGAGTGG - Intronic
1102005986 12:109589510-109589532 AACGCTGCCCTTTTGAGGAATGG + Intronic
1102047086 12:109836039-109836061 AATCCTGCCCTGCCGCTGATGGG + Intergenic
1102503564 12:113369532-113369554 AATGCCCAGCTGCTGATGAATGG + Intronic
1104414884 12:128589771-128589793 AAGGCTGCACTGCTGATAAGAGG - Intronic
1105007049 12:132727990-132728012 AAAGCTGCCCTGCGGGTGACAGG + Intronic
1105390046 13:19967456-19967478 AAATCTGCCCTGCTCATGAAGGG + Intronic
1108709904 13:53022818-53022840 TATGCTGTTCTTCTGATGAAAGG + Intergenic
1110249672 13:73367293-73367315 AAGGCTACCCGGCTGGTGAATGG - Intergenic
1110356237 13:74571079-74571101 AATGCTGACATGCTGATGCAAGG - Intergenic
1110837285 13:80098367-80098389 TATGCTGCCCTGTTTATGAAGGG + Intergenic
1110952191 13:81509460-81509482 AATACTGCTCTGTTGATCAAAGG + Intergenic
1111490706 13:88970679-88970701 GTGGCTGTCCTGCTGATGAATGG - Intergenic
1114833048 14:26168256-26168278 AATGCACTCCTGCTTATGAAAGG - Intergenic
1115135600 14:30103967-30103989 ACTACTACCCTGCTGATGATCGG - Intronic
1119206117 14:72794808-72794830 AATACAGCCCTGCTGATGCCTGG - Intronic
1121877004 14:97462228-97462250 AATGGTGTTCTGCTGGTGAAGGG - Intergenic
1124045019 15:26140666-26140688 ACTGCTTCCCTCCTGAAGAAAGG - Intergenic
1124184081 15:27506584-27506606 AATGCAGCCCTGCTGGTATATGG + Intronic
1124597341 15:31102059-31102081 AACACTGCCCAGCTGATGAGGGG - Intronic
1129777804 15:78248248-78248270 TAGGCTGCCCTGCTGAGAAAGGG - Intergenic
1130087482 15:80790003-80790025 AATAGAGCCCTGCTCATGAAGGG + Intronic
1132650524 16:1019578-1019600 ATTTCTGCGCTGGTGATGAAAGG - Intergenic
1132728790 16:1350553-1350575 AGTGGTGCCCTGATAATGAATGG + Intronic
1135525125 16:23208416-23208438 AATGCTACCCTGATCATGAGAGG - Intronic
1135984475 16:27173916-27173938 GATGTTGCCCTCCAGATGAACGG - Intergenic
1137002576 16:35242524-35242546 AGTGGTGCTCTGCTGAGGAAGGG - Intergenic
1137016471 16:35380687-35380709 AGTGTTGCTCTGCTGAGGAAGGG - Intergenic
1137018838 16:35402351-35402373 AGTGGTGCTCTGCTGAGGAAGGG - Intergenic
1138829916 16:60362513-60362535 AATGCAGCCTTGCTGATACATGG + Intergenic
1139624472 16:68175023-68175045 AATGCTCACCAACTGATGAATGG + Intronic
1139963515 16:70731486-70731508 AAGGCTGACCTGATGATGAAAGG + Exonic
1140816373 16:78624868-78624890 AATGCTGGCATGGTGATGAAAGG + Intronic
1141013696 16:80427402-80427424 AATCCAGCTCTGCTGTTGAAGGG - Intergenic
1141760123 16:86022738-86022760 AAAGCCGCCCAGCTGATGGATGG - Intergenic
1147008401 17:37423322-37423344 AATGCTGCCCTGAAGTTAAAAGG + Intronic
1147234562 17:39047714-39047736 ACTGCTGCCCTCCAGAAGAAAGG + Intergenic
1151065953 17:71150113-71150135 AATGCCCACCCGCTGATGAATGG + Intergenic
1153354341 18:4118880-4118902 AATGCTTTCCTCCTGATAAATGG + Intronic
1153385720 18:4493102-4493124 AATGCTGCACTTCTGAAGAGTGG - Intergenic
1153431587 18:5023240-5023262 AATGATGCCTTGCTGGTGACTGG - Intergenic
1155221114 18:23686871-23686893 AATGTTCCCCAACTGATGAATGG - Intergenic
1156882532 18:42098013-42098035 AATGTTTACCAGCTGATGAATGG + Intergenic
1157300184 18:46473459-46473481 CCTGCTGCTCTGCTGCTGAAGGG - Intergenic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1157757626 18:50232598-50232620 AAGACTGCCCTGATGATCAAAGG + Intronic
1159527347 18:69609775-69609797 AATGTTGATCAGCTGATGAATGG + Intronic
1159537173 18:69728725-69728747 AATGCTGCCCAGCAGATCCAAGG - Intronic
1165680663 19:37771945-37771967 AATTCAGACCTGCTGAGGAATGG + Intronic
925108869 2:1316688-1316710 AATGCTGGCCTGATGCTCAAAGG - Intronic
927560294 2:24066835-24066857 CAAGCTGCCATGATGATGAATGG + Intergenic
929867426 2:45730070-45730092 AGTGCTGCCCTGCTAATGTGTGG - Intronic
929927874 2:46230408-46230430 CCTGCTGCCCTGCTGGGGAAGGG - Intergenic
930202552 2:48558966-48558988 AATGCTGACCTGAGGCTGAAAGG + Intronic
932596907 2:73099642-73099664 AATCCTTGCATGCTGATGAAAGG + Intronic
934092012 2:88559847-88559869 AATGCTCATCAGCTGATGAATGG - Intronic
934603089 2:95673317-95673339 AATGCTGACCTCTTGAAGAAAGG + Intergenic
934724265 2:96605229-96605251 AAGGCTGACATGCTGGTGAATGG + Intronic
936160172 2:110078984-110079006 AAGGCTGGCCAGCTGAGGAAGGG - Intergenic
936184492 2:110292370-110292392 AAGGCTGGCCAGCTGACGAAGGG + Intergenic
936974848 2:118208610-118208632 AATGCTGACATGCACATGAATGG + Intergenic
937668589 2:124515258-124515280 AATGCTGCCCTGCTGATACTGGG + Intronic
937731149 2:125231345-125231367 AATGCTGTATTGCAGATGAAAGG - Intergenic
938250249 2:129809524-129809546 AATGCTGCCATGATGCTCAAAGG - Intergenic
939808401 2:146803594-146803616 CATGCTGTCCTTCTGATGAAGGG - Intergenic
942774860 2:179569226-179569248 TATGCTGCCTTGCTGATATAAGG + Intronic
942796439 2:179825962-179825984 AAAGCTGCCGAGCTGAGGAAGGG - Intronic
944347233 2:198684216-198684238 CAGGCTGCCCTGCTGAAGGAAGG - Intergenic
944370301 2:198974430-198974452 CAGGCAGCCCTGCTCATGAAGGG + Intergenic
944770454 2:202909286-202909308 AATGCCCACCAGCTGATGAATGG + Intronic
944979632 2:205101630-205101652 AATGCTCACCAGCTGATGAATGG + Intronic
945816641 2:214613024-214613046 GATGCTCCCCTGCTTATGATGGG - Intergenic
946757091 2:222958633-222958655 AATGCAGCCATCCTGATGCATGG - Intergenic
1168871320 20:1131025-1131047 AATGCTGCGCCTCTGAGGAAAGG + Intronic
1172894107 20:38287239-38287261 ACAGCTGTCCTGCTGATCAATGG + Intronic
1173125842 20:40335296-40335318 GAGGCTGCACTGCTGATAAATGG + Intergenic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1174661294 20:52215377-52215399 GATGCCGCACTGCTGAGGAAGGG + Intergenic
1174970360 20:55268164-55268186 AATTCTGCTCTGCTGTTTAAAGG - Intergenic
1175794780 20:61764827-61764849 GAGGCTTCCCTGCTGATGGAAGG - Intronic
1176246343 20:64099032-64099054 AAAGCTGCCCTCCTGGTGCAGGG + Exonic
1177817153 21:25989637-25989659 ATTGCTTTTCTGCTGATGAAAGG - Intronic
1178548489 21:33514604-33514626 AACAGTGGCCTGCTGATGAATGG - Intronic
1181036836 22:20173844-20173866 ACTGCTGCTCTGCGGATGAGGGG - Intergenic
1181822386 22:25486201-25486223 GTGGCTGCCCTGCTGATGGAAGG + Intergenic
1183656797 22:39190452-39190474 CATGCTGCCCTGCAGATGTCAGG - Intergenic
952239070 3:31511247-31511269 AATGCTGCTCAGCTGTTGACAGG - Intergenic
953432674 3:42852615-42852637 ACTCCTGCCCTGCTGAGGAATGG + Intronic
955752236 3:62194936-62194958 GATGCTTCCCTGCTGACCAAAGG - Intronic
955836263 3:63058702-63058724 AATGTTCCTCTCCTGATGAATGG + Intergenic
959811370 3:110623864-110623886 AAAGCTGCCCAGTTCATGAATGG + Intergenic
960961512 3:123073533-123073555 AAAGAGGCCCTGCTGATGTAGGG - Intronic
961752845 3:129107497-129107519 AATGTTTCCCTGGTGCTGAAAGG - Intronic
962136273 3:132737587-132737609 AATGCTGCCCTGAAAATGGAAGG + Intergenic
962470390 3:135702678-135702700 AGAGCTGCCCTGCTCATAAAAGG - Intergenic
963386742 3:144605838-144605860 ATTGTTTCCCTGTTGATGAATGG - Intergenic
965969394 3:174535149-174535171 AATTCTGCCCTGCTAGTCAATGG - Intronic
967844623 3:194033956-194033978 AATGAAGCCCTGCTTATTAAAGG + Intergenic
968594246 4:1474159-1474181 AATGGTGCCCTGGTGATGGAGGG + Intergenic
971177675 4:24295392-24295414 AATGCTGTTCATCTGATGAAAGG + Intergenic
972809672 4:42569160-42569182 ATGGCTGCTCTCCTGATGAATGG - Exonic
975844933 4:78515155-78515177 AATGCTGCCAAGCACATGAATGG - Intronic
976528747 4:86125513-86125535 TATGCTCCCCTGCTGCTCAAGGG + Intronic
976833069 4:89337180-89337202 ATTGATGCCCTGATGATGAGGGG - Intergenic
978833812 4:113122533-113122555 AATACTGACATACTGATGAAGGG - Intronic
979158974 4:117434634-117434656 ACTGCTGCCCTGCTGACACATGG - Intergenic
980134083 4:128843870-128843892 AAGGCTGCCCTGCTGTGGAGTGG + Intronic
983476444 4:168217851-168217873 AATGCAGCCCTGCTGACAACTGG + Intronic
985931187 5:3059003-3059025 AATGATAACCTGCAGATGAACGG + Intergenic
986678568 5:10212346-10212368 AATGTTTCCCTACTGGTGAATGG + Intergenic
986679534 5:10220813-10220835 AGGGCTGCCATGCAGATGAAAGG - Intergenic
989995922 5:50831351-50831373 AATGCCGCTCAGCTGATGGATGG + Intronic
990341047 5:54823429-54823451 AATCCTGCCTTGCCTATGAAAGG + Intergenic
990863020 5:60349460-60349482 AAATTTGCCCTACTGATGAATGG - Intronic
991037040 5:62137898-62137920 AATGCTGCCCTTCTTATATATGG + Intergenic
992952179 5:81870758-81870780 ATTGTTGCCATGTTGATGAATGG - Intergenic
995092341 5:108193173-108193195 CAGGCTGCCTTGCTGATGAAGGG + Intronic
996088348 5:119326528-119326550 AATGCTTCCCTGCTGCTCAGGGG - Intronic
997206444 5:132052963-132052985 AATGCAGCACTGCTGACAAAGGG + Intergenic
999432521 5:151536511-151536533 ATTCCTGCCCTGCTGCTGCAGGG - Intronic
1000352869 5:160365926-160365948 AAAGCTCACCTGCTGAAGAATGG - Intronic
1003229308 6:4236594-4236616 AAGGCTGCAGTTCTGATGAAAGG - Intergenic
1003469460 6:6415943-6415965 AATGCAGCCTTGTTGATAAAGGG + Intergenic
1004350813 6:14888799-14888821 GAAGCAGGCCTGCTGATGAAGGG - Intergenic
1004560430 6:16744331-16744353 CAGGCTGCCCTGCTAAGGAATGG - Intronic
1004814538 6:19298593-19298615 AACGCTGCTCTGCATATGAATGG + Intergenic
1005066926 6:21827397-21827419 AATGCAGCCCTACTAATGTAAGG + Intergenic
1006548150 6:34796732-34796754 AAGGCTGCCCTGCTGATTAGTGG - Intronic
1007296817 6:40829546-40829568 AATGCTTACCTCCTGATGAGTGG + Intergenic
1008411502 6:51185517-51185539 AATGGTGTCCTGCTCAAGAAAGG - Intergenic
1016374798 6:143409458-143409480 CATGCTGCCCTGCTGATGAGTGG - Intergenic
1016712565 6:147190375-147190397 AATGCTGCCATGGTGGTGAATGG - Intergenic
1017727509 6:157285705-157285727 AATGCTCCTTTTCTGATGAATGG + Intergenic
1019069198 6:169328039-169328061 AATGCCCCCCAGCAGATGAACGG + Intergenic
1021417459 7:20404695-20404717 AGTGCTGGGCTGCTGCTGAAGGG - Exonic
1023909785 7:44545480-44545502 ACTGCTGCCATGCTGGGGAAGGG - Intergenic
1026867723 7:73833641-73833663 AAGGCTGCCCTCCAGGTGAAAGG - Intergenic
1030446865 7:109656613-109656635 AAAGCTGCCCAAGTGATGAATGG + Intergenic
1031056842 7:117001154-117001176 ACTGCTGTGCTGCCGATGAAGGG + Intronic
1034700354 7:153090073-153090095 AATCCTGCCATTCTTATGAAAGG + Intergenic
1035688370 8:1542630-1542652 AATGCTGCCCGACGGATGAATGG - Intronic
1035770292 8:2141849-2141871 TGTGCTGCCCTGATGATGACTGG - Intronic
1036643365 8:10597692-10597714 AATGCTGCCCAGTTGAGGAGGGG - Intergenic
1039316139 8:36374698-36374720 CAGGCTGCCCTGCTGCTGAAGGG - Intergenic
1045524777 8:102932366-102932388 TAGGATGCCCTTCTGATGAATGG + Intronic
1045937513 8:107697925-107697947 AATTATGCCCTTCTGATGGATGG - Intergenic
1047122546 8:121922132-121922154 AATGCTGTCCAGCTCATAAAAGG - Intergenic
1047742808 8:127820381-127820403 AATGTTGCCCAGCTGTTGAGTGG + Intergenic
1048127866 8:131657095-131657117 AAAGCACCCCTGCTGATGAGAGG + Intergenic
1050113860 9:2242796-2242818 AATGGTGCCCTGATGTTTAATGG + Intergenic
1052337694 9:27336990-27337012 GAGGCTGCACTGCTGATTAATGG - Intronic
1055826192 9:80327917-80327939 AATGCTTACCAACTGATGAATGG + Intergenic
1056027415 9:82513435-82513457 AGTGCTGACCTGCTGAGAAATGG - Intergenic
1056949706 9:91032314-91032336 AAAGCTGTCCTTCTGCTGAAGGG + Intergenic
1056970521 9:91197360-91197382 AATGTTACACTGCTGATTAATGG - Intergenic
1057198749 9:93129437-93129459 CATGCACCCCTGCTGGTGAAGGG + Intronic
1057858754 9:98623531-98623553 AATGCTGCCCTGCTGACAACTGG - Intronic
1057928039 9:99170349-99170371 AACGCTGCCCTGTTAATTAATGG - Intergenic
1060968145 9:127723036-127723058 GATGCCACCCTGCTGAAGAAAGG + Intronic
1061271785 9:129547887-129547909 AAGGCTGCACTGCTCAAGAATGG - Intergenic
1061322012 9:129836601-129836623 AATGCTGCCCTGCTTCGGAATGG - Intronic
1061769052 9:132903640-132903662 AATGCTGCCATGGTGAGGACTGG - Exonic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1186749326 X:12605502-12605524 CCAGCTGCCCTGCTGATGACAGG - Intronic
1187208334 X:17204230-17204252 AAGGTTGCCCAGCTGGTGAATGG + Intergenic
1189174081 X:38936481-38936503 AAGGCTACCCTGCTGAAGAGAGG + Intergenic
1190055880 X:47180681-47180703 AAAGCTGCGGTGATGATGAAGGG - Intronic
1191615637 X:63167118-63167140 AAGGCTGCTCATCTGATGAAAGG - Intergenic
1191620661 X:63211805-63211827 AAGGCTGCTCATCTGATGAAAGG + Intergenic
1192183163 X:68928980-68929002 AATGATGCCCAGCTGAAGAATGG + Intergenic
1198575478 X:138005840-138005862 AATGCTTTCTTGCTGAGGAAAGG - Intergenic
1201065363 Y:10090767-10090789 GGTGCTGCCCTGCTGCTGCACGG + Intergenic