ID: 1088863620

View in Genome Browser
Species Human (GRCh38)
Location 11:113825246-113825268
Sequence CAGTGCCAAGATAATTCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1021
Summary {0: 1, 1: 12, 2: 51, 3: 239, 4: 718}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088863616_1088863620 8 Left 1088863616 11:113825215-113825237 CCCCATGTATATGTTCAATTAAT 0: 1
1: 1
2: 17
3: 242
4: 1353
Right 1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG 0: 1
1: 12
2: 51
3: 239
4: 718
1088863618_1088863620 6 Left 1088863618 11:113825217-113825239 CCATGTATATGTTCAATTAATTT 0: 1
1: 0
2: 8
3: 79
4: 920
Right 1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG 0: 1
1: 12
2: 51
3: 239
4: 718
1088863617_1088863620 7 Left 1088863617 11:113825216-113825238 CCCATGTATATGTTCAATTAATT 0: 1
1: 0
2: 3
3: 98
4: 879
Right 1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG 0: 1
1: 12
2: 51
3: 239
4: 718
1088863615_1088863620 9 Left 1088863615 11:113825214-113825236 CCCCCATGTATATGTTCAATTAA 0: 1
1: 0
2: 2
3: 44
4: 324
Right 1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG 0: 1
1: 12
2: 51
3: 239
4: 718
1088863614_1088863620 20 Left 1088863614 11:113825203-113825225 CCAGATATAGACCCCCATGTATA 0: 1
1: 0
2: 8
3: 47
4: 399
Right 1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG 0: 1
1: 12
2: 51
3: 239
4: 718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088863620 Original CRISPR CAGTGCCAAGATAATTCAAT GGG Intronic
900859138 1:5213440-5213462 AAATGTCAAGGTAATTCAATGGG + Intergenic
901128543 1:6947077-6947099 GGATACCAAGATAATTCAATGGG - Intronic
901531411 1:9855512-9855534 GGGTGCCAAGACAATTCAGTGGG + Intronic
901901246 1:12365026-12365048 CAGTACCAAGATCATTTAATGGG - Intronic
902064947 1:13677230-13677252 CATTGCCAAGAAAATTCAATGGG - Intergenic
902726986 1:18343708-18343730 GGATGCCAAGATAATTCAATGGG - Intronic
903150894 1:21407829-21407851 GAGTGCCAAAATCATTCAATGGG - Intergenic
903611231 1:24614877-24614899 GAGTACCAAGATAATTCAATGGG - Intergenic
904550071 1:31308598-31308620 CACTGCCAAGATAAATCTAATGG - Intronic
904859998 1:33529511-33529533 GAGTGTCAAGACAATTCAACAGG + Intronic
905546701 1:38805454-38805476 AGTTGCCAAAATAATTCAATGGG + Intergenic
905712200 1:40115502-40115524 AGGTGCCAAGACCATTCAATGGG + Intergenic
905973687 1:42159819-42159841 AAGTGCCAAGATCACACAATGGG - Intergenic
906138543 1:43518758-43518780 AAGTGCCAAGGAAATTCAATGGG - Intergenic
906419875 1:45656614-45656636 AAGTACAAAGGTAATTCAATGGG - Intronic
906756252 1:48318994-48319016 AGATGCCAAGACAATTCAATGGG + Intronic
906959528 1:50409408-50409430 GGGTCCCAAGACAATTCAATGGG + Intergenic
907083418 1:51645877-51645899 GAGTGCCAAGACTATCCAATAGG - Intronic
907204311 1:52755271-52755293 GAATGCCAGGATAATTCAACGGG - Intronic
907368690 1:53983243-53983265 GGGTGCCAAGATAATTGAAAGGG + Intergenic
907478652 1:54727234-54727256 GTGTGCCAAGACCATTCAATAGG + Intronic
907568107 1:55456255-55456277 ACGTGCCAAGGTAATCCAATGGG + Intergenic
907655647 1:56339746-56339768 AGGTGCTAAGGTAATTCAATGGG - Intergenic
908291781 1:62674684-62674706 TGGTGCCAAGGCAATTCAATTGG + Intronic
908430985 1:64057269-64057291 GAGTGCCAAGACAATTCAATGGG - Intronic
908855668 1:68424359-68424381 AAGTGCTAAGAAAATTCAATGGG - Intergenic
909125517 1:71663558-71663580 AAATGCAAAAATAATTCAATGGG - Intronic
909226305 1:73027821-73027843 GTGTGCCAAGATAATTAAATGGG + Intergenic
909550260 1:76891844-76891866 AAATGCCAAGACAATTGAATAGG - Intronic
910502756 1:87911889-87911911 GAGTGCCAAGATAGTTCAGTGGG - Intergenic
910782784 1:90958693-90958715 AAGTGCCAAGACCATTCAATGGG + Intronic
910932233 1:92454029-92454051 AACTACCAAGATAATTCAATGGG - Intergenic
912064120 1:105713998-105714020 GAGTGCCAAGACAATTCAATGGG - Intergenic
912277530 1:108274868-108274890 CAGTGCAAAGACCATTCAATAGG - Intergenic
912290698 1:108419490-108419512 CAGTGCAAAGACCATTCAATAGG + Intronic
913038008 1:114992520-114992542 GAGTGCCAAGACCATTCAATGGG + Intronic
913038129 1:114994483-114994505 CAGTAACAAAATAAATCAATTGG - Intronic
913125820 1:115788544-115788566 TGTTGTCAAGATAATTCAATGGG + Intergenic
913184046 1:116351418-116351440 CAATGCCAAGACCATTCAATGGG + Intergenic
913301948 1:117380633-117380655 GAGTGCCAATATTATTCAATAGG - Intronic
913373498 1:118126951-118126973 AAGTGCCAAGAACATACAATAGG - Intronic
913378227 1:118179309-118179331 CAGTGCCAAGAGCTTACAATAGG + Intronic
913572677 1:120136696-120136718 AAGAGCCAAGACAATTCAATGGG + Intergenic
914293521 1:146297610-146297632 AAGAGCCAAGACAATTCAATGGG + Intergenic
914324338 1:146596859-146596881 CAGGGCCAAGATACCTAAATTGG + Intergenic
914384023 1:147150170-147150192 GGGTGCCAAGACCATTCAATGGG + Intergenic
914554565 1:148748393-148748415 AAGAGCCAAGACAATTCAATGGG + Intergenic
915712506 1:157914488-157914510 GGGTGCCAAGAACATTCAATGGG + Intergenic
915990497 1:160511447-160511469 GAGTGCTAAGATCATTCAATAGG + Intronic
916300869 1:163272674-163272696 CAGTGCCAAGACAATTCAAAGGG - Intronic
916336925 1:163683006-163683028 GGGTGCCAAGATCAGTCAATGGG + Intergenic
916710956 1:167407624-167407646 AGGTGCCAAGGCAATTCAATAGG + Intronic
917001787 1:170368478-170368500 AAGTGCCAAGGTATTTCAATGGG + Intergenic
917322227 1:173795441-173795463 AAGTGACAAGACACTTCAATAGG + Intergenic
918155259 1:181839045-181839067 TAGTGCCAAGACCATTCAATGGG + Intergenic
918224498 1:182468896-182468918 GGGTGCCAAGACCATTCAATGGG + Intronic
918486726 1:185036523-185036545 GAGTCCCAAGATAATTATATAGG + Intergenic
918587093 1:186200734-186200756 AAGTGCCAAGGCAATTCAATGGG - Intergenic
918687692 1:187439424-187439446 AATTGCCAACATAATTAAATGGG - Intergenic
918753244 1:188300550-188300572 GAGTGCCAAGAAGATTAAATGGG + Intergenic
918810589 1:189114157-189114179 ACGTGCCAATAAAATTCAATAGG - Intergenic
919099695 1:193079408-193079430 GGGTGCCAAGATGATTCACTGGG + Intronic
919117397 1:193297481-193297503 AAGGGGCAAGGTAATTCAATGGG + Intergenic
919295382 1:195692524-195692546 GAGTGCCAAGATCATTGAGTGGG + Intergenic
919570139 1:199238072-199238094 GGGTGCCAAGACCATTCAATAGG - Intergenic
919867983 1:201797246-201797268 GAGTGCCAAGACAATTCAGTGGG - Intronic
919936849 1:202257584-202257606 CAGTGCTAAGACAATTCAATAGG - Intronic
920077344 1:203347091-203347113 CAGTGCTAAGACAATTCAGTGGG - Intronic
920267966 1:204739895-204739917 AAGTGTTAAGACAATTCAATGGG - Intergenic
920520738 1:206623712-206623734 GACTACCAAGACAATTCAATGGG - Intergenic
921038922 1:211410589-211410611 AAGCGTCAAGATAATTCAATGGG + Intergenic
921970667 1:221145932-221145954 AAGTGCCAAGGCAATTCAATGGG - Intergenic
922112316 1:222572678-222572700 GGGTGCCAAGACAATTCAGTGGG + Intronic
922253596 1:223872261-223872283 AAGGGCCAAGATAATTAAACAGG - Intergenic
922372058 1:224921459-224921481 CAGTGCAAAGAAAATGCCATGGG + Intronic
922540097 1:226412454-226412476 GGGTGCCAAGATCATTCAGTGGG - Intergenic
922793933 1:228328916-228328938 GAATTCCAAGACAATTCAATGGG - Intronic
922926790 1:229354350-229354372 GGGTGCCAAGACCATTCAATGGG - Intergenic
923053762 1:230408590-230408612 AGGTGTCAAAATAATTCAATGGG + Intronic
923459866 1:234199363-234199385 CAGTGCCAAGAAGACACAATGGG + Intronic
924220307 1:241867687-241867709 CTGTGCCAAGGCAATTAAATGGG - Intronic
924220434 1:241869286-241869308 ATGTGCCAAGACAATTAAATGGG + Intronic
924285329 1:242480235-242480257 TAATGCCAAGAAAATCCAATTGG + Intronic
924489362 1:244520401-244520423 AAGTTCCAAAACAATTCAATGGG - Intronic
924505127 1:244675544-244675566 AGGTGCCAAGACAATTCAGTGGG - Intronic
1063599920 10:7471495-7471517 ATGTGCTAAGACAATTCAATGGG + Intergenic
1063792337 10:9466735-9466757 GTGTGCCAAAATAATCCAATAGG + Intergenic
1065120639 10:22526790-22526812 GGGTGCCAAGACAATTCAGTAGG - Intergenic
1065245991 10:23758323-23758345 GAGTGCCAAGACTATTCACTGGG - Intronic
1065302614 10:24336786-24336808 CAGTGCCAAGATCATTCCATTGG + Intronic
1065835464 10:29653804-29653826 CAATGCCAAAACAATTCAATGGG - Intronic
1066246430 10:33587677-33587699 CAGTGCAAAGATCACTCAATAGG + Intergenic
1066583212 10:36902944-36902966 CAATCCCAAGATAAGTTAATAGG + Intergenic
1066627529 10:37423124-37423146 AGGTGCCAAGACATTTCAATGGG - Intergenic
1066666440 10:37787553-37787575 AAGTGCCAAGATACTTCAAGAGG + Intronic
1066674077 10:37870279-37870301 GGGTGCCAAGACAATACAATGGG - Intergenic
1067361712 10:45587799-45587821 AAATGCCAAGAGAACTCAATGGG + Intronic
1067466848 10:46506653-46506675 GAGTGCCAAGACCATTCAATGGG + Intergenic
1067513644 10:46916975-46916997 AGGTGCCAAGATAATATAATGGG - Intronic
1067620339 10:47877952-47877974 GAGTGCCAAGACCATTCAATGGG - Intergenic
1067648608 10:48134859-48134881 AGGTGCCAAGATAATATAATGGG + Intergenic
1067678665 10:48411378-48411400 GGGTGCCAAGACCATTCAATGGG - Intronic
1067770863 10:49123686-49123708 GAGTGCCAAGATAATTTAATGGG - Intergenic
1067889550 10:50122205-50122227 AGGTGCCAAGATATTTCAGTGGG + Intronic
1068139012 10:52980942-52980964 AAGTGCCAAGGTAATTAAATGGG - Intergenic
1068200053 10:53772302-53772324 AAGTACCAAAATAACTCAATTGG - Intergenic
1068295567 10:55068366-55068388 AATTGCCAAGAAAATTCACTGGG - Intronic
1068330905 10:55567155-55567177 CGGTGTCAAGAGTATTCAATGGG + Intronic
1068457645 10:57279333-57279355 CACTGCCAAGATAATACAACGGG + Intergenic
1068473281 10:57492536-57492558 AAGTGCCAAGAAAATACAATGGG + Intergenic
1069011293 10:63376162-63376184 CAGTGTCAAGACCATTCACTGGG + Intronic
1069205425 10:65676828-65676850 AAGTGCAAAGACAATTCAATAGG - Intergenic
1069210721 10:65756285-65756307 GGTTGCCAAGATCATTCAATGGG - Intergenic
1069324609 10:67218062-67218084 CATTCCCAAGATAATTCATTAGG + Intronic
1069523633 10:69147672-69147694 AGGTGCCAAAACAATTCAATGGG - Intronic
1069852025 10:71413243-71413265 GGGTGCTAAGATCATTCAATGGG - Intronic
1070084206 10:73219631-73219653 GGGTGCCAAGATCATTCAATGGG + Intronic
1070443787 10:76474086-76474108 GAGTACAAAGATAATTCACTGGG + Intronic
1070446751 10:76512452-76512474 TGGTGCCAAGACATTTCAATGGG + Intronic
1070937413 10:80311581-80311603 GGGTGCCAAGAACATTCAATAGG + Intergenic
1071168908 10:82840465-82840487 CAATGACATCATAATTCAATTGG + Intronic
1071298605 10:84240420-84240442 CATTGCCAAGATTATTAAAAGGG + Intronic
1071618883 10:87100351-87100373 GAGTGTGAAGACAATTCAATGGG - Intronic
1071699011 10:87909120-87909142 GAGTGCCAAGACTATTCAATGGG - Intronic
1071995595 10:91145735-91145757 GAGTGCCAAGACAATTCAATGGG + Intergenic
1071999266 10:91178034-91178056 CAGTTCCAAGATGACTGAATAGG - Intronic
1072609684 10:97009364-97009386 GAGTGCCATGACCATTCAATTGG + Intronic
1072825557 10:98602683-98602705 AAGTGCCAAGATGATTAAATGGG + Intronic
1072837553 10:98732509-98732531 AGGTGCCAAGATAAGTAAATGGG + Intronic
1072976014 10:100058912-100058934 GAATGCCAAGACCATTCAATGGG + Intronic
1073171629 10:101514755-101514777 AGATGCCAAGATAATTCAATGGG - Intronic
1073581488 10:104670453-104670475 AGGTGCAAAGACAATTCAATGGG - Intronic
1073874496 10:107906503-107906525 AAGTGCCAAGAGAATTAAAGAGG + Intergenic
1074135513 10:110622924-110622946 TGGTGCCAGGATAATTCAATGGG - Intergenic
1074444419 10:113507571-113507593 AGGTGCCAAGACTATTCAATGGG - Intergenic
1074744435 10:116517580-116517602 CAGTGCCATGGTAATACAGTCGG - Intergenic
1075268192 10:121024263-121024285 AAATGCCAAGGTAATTCAAAGGG + Intergenic
1075272684 10:121066595-121066617 AAGTGCCAAGACCATTCAATGGG - Intergenic
1076004558 10:126938415-126938437 GAGAGCCAAGACCATTCAATGGG - Intronic
1076628542 10:131838331-131838353 AAGTGCAAAGACAATTCAATGGG + Intergenic
1076812621 10:132896988-132897010 CAGTGCCAAGACCATTCACTAGG + Intronic
1077403743 11:2372596-2372618 GGGTACCAAGACAATTCAATGGG - Intergenic
1077437912 11:2552347-2552369 AGGTGCCAAAGTAATTCAATGGG - Intronic
1077449273 11:2626382-2626404 GAGTGCCAAGACCATTCAATAGG - Intronic
1077908505 11:6554206-6554228 ATGTGCCAAGATAATTCAATGGG + Intronic
1077982190 11:7311404-7311426 CAGTACTAAGAAAATTCAAAGGG + Intronic
1079600816 11:22311671-22311693 AAGTGTCAAAAAAATTCAATAGG + Intergenic
1080089547 11:28329216-28329238 GAGTGCCAAGACCATTCAATTGG - Intronic
1080349083 11:31360960-31360982 CAGTACCAAGATTATTAAATTGG + Intronic
1080359532 11:31495745-31495767 GGGTGCCAAGACCATTCAATGGG + Intronic
1080506709 11:32921975-32921997 AGGTGCCAAGACAATTCAATAGG + Intronic
1080534733 11:33210515-33210537 CAGTGCCAAGACCACTCAATGGG + Intergenic
1081539440 11:44020017-44020039 GGGTGCCAAGATAATTCAGTGGG - Intergenic
1081624324 11:44639260-44639282 GGATGCCAAGACAATTCAATGGG + Intergenic
1081943074 11:46961824-46961846 CAGTGCCAAAAACACTCAATGGG - Intronic
1082644834 11:55709790-55709812 CAGTGCCAAGATTATTCAATAGG - Intergenic
1083425646 11:62583844-62583866 CGGTGTCAAGAAGATTCAATGGG + Intronic
1084094231 11:66900006-66900028 GAGCGCCAAGACAATTTAATGGG - Intronic
1084159790 11:67340936-67340958 CAGTGCCAACGTAATTAAGTGGG + Intronic
1084896919 11:72278739-72278761 GGGTGCCAAGATTATTCAATGGG - Intergenic
1085149856 11:74242242-74242264 AGGTGCCAAGACAATTAAATGGG - Intronic
1085436022 11:76503487-76503509 AGATGCCAAGATCATTCAATGGG + Intronic
1085485201 11:76857780-76857802 GGATGCCAAGACAATTCAATAGG - Intergenic
1085926518 11:81030151-81030173 AGGTGCCATGATTATTCAATTGG - Intergenic
1086397083 11:86426843-86426865 AAGTGCCAAGAATATACAATGGG - Intergenic
1087209182 11:95428938-95428960 GGATGTCAAGATAATTCAATGGG + Intergenic
1087906012 11:103698511-103698533 TAGTGCCAAGACAATTCAATGGG - Intergenic
1087997901 11:104834088-104834110 CAGTGTCAAGAACATACAATGGG - Intergenic
1088139616 11:106599826-106599848 CGATGCCAAGATCATTTAATGGG + Intergenic
1088863620 11:113825246-113825268 CAGTGCCAAGATAATTCAATGGG + Intronic
1089194381 11:116685269-116685291 AGGTACCAAGGTAATTCAATGGG + Intergenic
1089266615 11:117267809-117267831 AAGTGCCAAGGTACCTCAATGGG - Intronic
1089357533 11:117864316-117864338 GGGTGCCAAGACCATTCAATGGG + Intronic
1089686594 11:120152669-120152691 AGGTGCCAAGGTAATTCAACGGG - Intronic
1089799296 11:121011708-121011730 GGGTGCCAAGACCATTCAATGGG + Intergenic
1089871485 11:121676736-121676758 AACTGCCAAGGTAATTCAATGGG - Intergenic
1090043113 11:123308057-123308079 CAGTGCATAGAAAAATCAATCGG + Intergenic
1090123503 11:124058549-124058571 CGGAGCCAAGACCATTCAATAGG - Intergenic
1090140773 11:124258048-124258070 CAGAGAGGAGATAATTCAATGGG - Intergenic
1090496512 11:127217958-127217980 CAGTGCAAGGAGAATACAATGGG + Intergenic
1090760176 11:129829910-129829932 AGATGCCAAGACAATTCAATAGG + Intronic
1090766812 11:129883371-129883393 CAGTATCAAGTTAATTAAATGGG - Intronic
1090966747 11:131604819-131604841 GTGTGCCAAGAAAATTCAATGGG - Intronic
1091035854 11:132232760-132232782 CAGTGCCAAGAAAATAAAAAAGG + Intronic
1091313266 11:134590776-134590798 AAGTGCCAGGGCAATTCAATGGG - Intergenic
1091480142 12:819829-819851 GAGTACCAAGACCATTCAATAGG - Intronic
1091707662 12:2709727-2709749 GGGTGCCAAGACCATTCAATGGG + Intergenic
1092037856 12:5355496-5355518 AAGTGCCAAGACAATTCAATGGG + Intergenic
1092340560 12:7672415-7672437 AGGTGCCAAGATAATCCAATGGG - Intergenic
1092363631 12:7859063-7859085 GGGTGCCAAGATTATTCAATGGG - Intronic
1092632656 12:10399525-10399547 GAGTGCCAAGACCATTCAATGGG + Intronic
1092734732 12:11569634-11569656 GAGTGTCCAAATAATTCAATAGG - Intergenic
1093322472 12:17730228-17730250 GAGTGCCAAGATTATTCAATGGG + Intergenic
1093509669 12:19911591-19911613 AAGTGCCAAGAACATACAATGGG - Intergenic
1093975627 12:25418520-25418542 AGGTGCCAAGTCAATTCAATAGG - Intronic
1094457057 12:30647180-30647202 GAATGCCAAGACAATTCAATGGG + Intronic
1094645067 12:32315228-32315250 GGGTACAAAGATAATTCAATAGG - Intronic
1094683510 12:32687400-32687422 CAATGCCAAGACTATTCAATGGG - Intronic
1094784842 12:33835906-33835928 AGGTGCCAAGAAAATTCAACAGG + Intergenic
1095141699 12:38671749-38671771 CAGTGCTTAGATAATGCATTTGG + Intronic
1095220132 12:39601936-39601958 CATTGGCAAAATATTTCAATAGG + Intronic
1095282029 12:40363583-40363605 AAGTGCAAAGATAATTCTTTTGG - Intronic
1095546777 12:43381118-43381140 GGATGCCAAGCTAATTCAATGGG + Intronic
1095883202 12:47161338-47161360 CGGTACTAAGATAATTCAATGGG - Intronic
1096762892 12:53857943-53857965 AAGTGCCAAGACAATTCAGTGGG + Intergenic
1097132852 12:56825906-56825928 GGGTGCCAAGACCATTCAATGGG - Intergenic
1097135661 12:56852589-56852611 GAGTGCCAAGACAATTCAATAGG - Intergenic
1097936700 12:65260414-65260436 GGGTGACAAGACAATTCAATTGG - Intergenic
1098039786 12:66342269-66342291 GGGTACCAAGATAATTCAATGGG - Exonic
1098349721 12:69545836-69545858 GGGTGCCAAGACTATTCAATGGG + Intronic
1098427427 12:70380697-70380719 GAGTGTCAAGAGCATTCAATAGG + Intronic
1098566005 12:71936713-71936735 ACGTGCCAAGACAATTCAATGGG - Intergenic
1098945040 12:76580495-76580517 GGGTGCCAAGATAACACAATGGG + Intergenic
1099306326 12:80960465-80960487 GGGTGCCAAGACAGTTCAATGGG - Intronic
1099306351 12:80961061-80961083 GGGTGCCAAGACAGTTCAATGGG - Intronic
1099342824 12:81459717-81459739 CAGTGCCATGATAATAAAAAAGG - Intronic
1100075347 12:90774343-90774365 ATGTGCCAAGATAATTTAACAGG - Intergenic
1100252420 12:92841190-92841212 GGGTGCCAAGATTATTCAACGGG + Intronic
1100401005 12:94229663-94229685 GGGTGCCAAGACCATTCAATGGG - Intronic
1100424218 12:94468135-94468157 GGGTGCCAAGACCATTCAATGGG + Intergenic
1100601915 12:96119063-96119085 GAATGCCAAGACAGTTCAATGGG + Intergenic
1101498928 12:105283034-105283056 GGGTGCTAAGATAATTCAATGGG + Intronic
1102069628 12:110006964-110006986 GGGTGCCAAAATAATTCATTGGG - Intronic
1102326160 12:111986479-111986501 GGGTGCCAAGATCATTTAATGGG + Intronic
1102449689 12:113031993-113032015 GGGTGCCAAGACTATTCAATGGG + Intergenic
1102664553 12:114559759-114559781 AAGTACCTAGAAAATTCAATAGG - Intergenic
1102949099 12:117016898-117016920 TGGTGCCAAGACAATTGAATGGG - Intronic
1103423111 12:120806377-120806399 CGGTGCCAAGGTAATTCAACTGG + Intronic
1103493483 12:121342284-121342306 CAGTGCCAAGACCATTTGATAGG + Intronic
1103692334 12:122785434-122785456 CATCACCAACATAATTCAATAGG + Intronic
1104403776 12:128500082-128500104 GAGTGTCAAGACAATTCAGTGGG + Intronic
1105494102 13:20915166-20915188 TAGTGCCAAGACCATTCAATGGG + Intergenic
1105774793 13:23647845-23647867 GAGTGCCAATACCATTCAATGGG - Intronic
1105906410 13:24814634-24814656 GGGTGCCAAGACCATTCAATGGG - Intronic
1106238863 13:27891265-27891287 GAGTGCCAAGATTATTCAGTGGG - Intergenic
1107067912 13:36236374-36236396 GAGTGCCAAGAGCATTTAATTGG + Intronic
1107201756 13:37728904-37728926 TGGTGCCAAGACCATTCAATAGG + Intronic
1107257674 13:38448144-38448166 GAGTGCCAAAACAATTCAGTGGG - Intergenic
1107271841 13:38628341-38628363 GTGTGCCAAGATAATTAACTGGG - Intergenic
1107918029 13:45172716-45172738 AGGTGCCAAGAGAATTCAATGGG - Intronic
1108487282 13:50939653-50939675 AAGTGTGAAGATAATTCAGTGGG + Intronic
1108886709 13:55194266-55194288 CAGTGCCATGATAAGTAAAATGG + Intergenic
1109315814 13:60747951-60747973 CAGTGACAAGATAATTAACATGG + Intergenic
1109367828 13:61380410-61380432 TAGTGCCAAGACAATTCCACAGG + Intergenic
1110400589 13:75086542-75086564 GAGTGCCAAGACACTTTAATGGG + Intergenic
1110732463 13:78895069-78895091 AGGTGCCAAGGCAATTCAATGGG - Intergenic
1110965200 13:81685905-81685927 TAGTGTGAAGATAATTCAGTAGG - Intergenic
1111730411 13:92069129-92069151 GGATGCCAAGAAAATTCAATAGG - Intronic
1112403517 13:99097209-99097231 CAGTGCTAAGACCATTCAGTGGG + Intergenic
1112605982 13:100906542-100906564 GAGTGCCAAGAACATTCAGTGGG + Intergenic
1112759934 13:102683637-102683659 AGGTGCCAAAGTAATTCAATGGG - Intergenic
1112866271 13:103903947-103903969 GGGTACTAAGATAATTCAATTGG - Intergenic
1113265650 13:108614698-108614720 CAGTGCCAAGACTATTCTATGGG + Intronic
1113283991 13:108826297-108826319 GAATGCCAAGATGATTCTATGGG + Intronic
1113631401 13:111887688-111887710 AGGTGCCAAGACAATTCAATGGG - Intergenic
1113924609 13:113934550-113934572 AGGTGCCAAGACAACTCAATGGG + Intergenic
1114172608 14:20288701-20288723 CCGTGCCAGGCCAATTCAATTGG + Exonic
1114180301 14:20361155-20361177 GGGTGCCAAGACCATTCAATGGG + Intergenic
1115775228 14:36707496-36707518 CAGTGCCTAGATCATTAAATCGG + Intronic
1115966408 14:38894408-38894430 AAGTGCCAAGAATATACAATGGG + Intergenic
1116111318 14:40588385-40588407 CAGTGCCAAAATTATTCATATGG + Intergenic
1116142649 14:41018833-41018855 GGCTGCCAAGTTAATTCAATGGG - Intergenic
1116506192 14:45684793-45684815 AAGTGCCAAGAACATACAATAGG - Intergenic
1116604364 14:46970425-46970447 TAGTGCCAAGAACATACAATGGG + Intronic
1116754806 14:48933964-48933986 AGGTGCCAAAGTAATTCAATGGG + Intergenic
1117010503 14:51466518-51466540 AAGTGCCAAAATGATTCAATGGG - Intergenic
1117120303 14:52560636-52560658 AAGTGCCAAGGTAATTTAGTGGG + Intronic
1117607910 14:57450088-57450110 CAATGGCATGATAAATCAATAGG - Intergenic
1117640801 14:57797449-57797471 CAGTGACAATATATTTTAATGGG - Intronic
1117774517 14:59169004-59169026 TGGTGTCAAGACAATTCAATGGG + Intergenic
1117800375 14:59437718-59437740 GTGTCCCGAGATAATTCAATGGG + Intronic
1118218948 14:63837171-63837193 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1118298514 14:64592734-64592756 GGGTGCCAAGACAATTCAATGGG + Intergenic
1118557127 14:67037159-67037181 TGGTGCCAAGACCATTCAATGGG + Intronic
1118928895 14:70221112-70221134 GTGTGCCAAGACCATTCAATGGG - Intergenic
1119056254 14:71423577-71423599 GAGCGCCAAGACCATTCAATGGG - Intronic
1119176482 14:72571548-72571570 GAGTGTCAAAACAATTCAATAGG + Intergenic
1119523832 14:75306506-75306528 AAGTGCCAAGACCATTCAATGGG - Intergenic
1119581441 14:75785634-75785656 GAGTGCCAAGACAATCCCATGGG - Intronic
1120368416 14:83600736-83600758 AGGTGCCAAGATGAATCAATGGG - Intergenic
1120635761 14:86949002-86949024 AAGTGCCAAGAAAGTTCAATGGG - Intergenic
1120806518 14:88757199-88757221 TGGTGCCAAGACAATTCAATGGG + Intronic
1120833519 14:89019651-89019673 GAGTGCCTAGAAAATTCAATGGG - Intergenic
1120963083 14:90142667-90142689 CAGTGCCAAGGCAATTCACTTGG - Intronic
1121248123 14:92478405-92478427 GAGTATCAAGACAATTCAATAGG - Intronic
1121316875 14:92966818-92966840 GGGTGCCAAGACAATTCAAGGGG + Intronic
1121346894 14:93142938-93142960 CAGTGCCAAGCTTTTTCAAAAGG - Intergenic
1121581171 14:95032423-95032445 TGGTGCCAAGATAATTCAATGGG - Intergenic
1121726337 14:96154164-96154186 AAGTGCCGATATAATCCAATGGG + Intergenic
1121912545 14:97804540-97804562 ATGTGCCAAAATAATTCAACTGG + Intergenic
1122583852 14:102790281-102790303 GGGTGCCAAGACGATTCAATAGG - Intronic
1202901669 14_GL000194v1_random:46947-46969 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1123704531 15:22941464-22941486 CAATGCCAAGATAACTCATATGG - Intronic
1123792933 15:23740831-23740853 AAGTTCCAAAACAATTCAATGGG - Intergenic
1123807000 15:23884294-23884316 TATTACCAAGACAATTCAATAGG - Intergenic
1124427699 15:29576206-29576228 GGGTGCCAAGTTCATTCAATGGG + Intergenic
1124475603 15:30031409-30031431 GAGTGCCAAGATCATTCAAAGGG - Intergenic
1124485089 15:30106915-30106937 GCGTTCCAAGACAATTCAATGGG - Intergenic
1124518488 15:30390354-30390376 GCGTTCCAAGACAATTCAATGGG + Intronic
1124540166 15:30575895-30575917 GCGTTCCAAGACAATTCAATGGG - Intergenic
1124758485 15:32431682-32431704 GCGTTCCAAGACAATTCAATGGG + Intergenic
1125120365 15:36150947-36150969 GAGTGTCAAGTTCATTCAATGGG + Intergenic
1125215374 15:37266974-37266996 GGGTGCCAAGACAATTCAATGGG + Intergenic
1125275638 15:37987630-37987652 GTGTGCCAAGACAATTCACTGGG - Intergenic
1125830445 15:42712582-42712604 GGGTGCCAAGACAATTCAATGGG - Intronic
1125850778 15:42900898-42900920 GAGTCCCAAGATCACTCAATGGG + Intronic
1125890642 15:43263536-43263558 AGGTGCCAAGACAATTCAATGGG + Intronic
1126354412 15:47780072-47780094 CAATACCAAGACCATTCAATAGG + Intergenic
1126570770 15:50147888-50147910 GAGTGCCAAAATCATTCAGTGGG + Intronic
1126770860 15:52054463-52054485 AAGTGTCAAGATAATTCAGTGGG - Intronic
1127178298 15:56385116-56385138 AAGTGCTAAGAACATTCAATGGG - Intronic
1127209241 15:56755622-56755644 GTGTGCCAAGACAATTCAATGGG + Intronic
1127218599 15:56851875-56851897 GGATGCCAAGACAATTCAATGGG + Intronic
1127283747 15:57514866-57514888 GGGTGCCAAGACAATTCAATGGG - Intronic
1127738479 15:61871357-61871379 GGATGTCAAGATAATTCAATAGG - Intronic
1128271059 15:66310207-66310229 CAGGGCCAAGAAAATTCTATTGG - Intronic
1128316815 15:66665222-66665244 AGTTTCCAAGATAATTCAATGGG - Intronic
1128381033 15:67112906-67112928 GGGTGCCAAGACAATTCACTGGG - Intronic
1128592710 15:68915981-68916003 GAGTGCCAAGACTGTTCAATAGG + Intronic
1128663074 15:69517037-69517059 GGGTGCCAAGACCATTCAATGGG - Intergenic
1128899322 15:71405456-71405478 AGGTGCCAAGACAATTCATTAGG - Intronic
1129663015 15:77563736-77563758 GAGAGCCAAGACCATTCAATGGG - Intergenic
1130038328 15:80381543-80381565 CAGTGCCAAGAACATACATTGGG + Intronic
1130121952 15:81057891-81057913 AAGTGCCAAAACAATTCAATGGG - Intronic
1130307659 15:82725281-82725303 CAATCCCAAGATAATTCAGTGGG - Intergenic
1130758591 15:86793363-86793385 GAGTTCCAAGATCATTCAGTAGG + Intronic
1131470229 15:92690170-92690192 AAGTGGCAAGATAAGTCACTAGG - Intronic
1131924809 15:97370930-97370952 CAGTGCCAAGACAAATCATCAGG + Intergenic
1132127885 15:99245610-99245632 GCATGCCAAGATAATTCAATGGG + Intronic
1132166778 15:99600670-99600692 TGGTGCCATGATAATTCAACAGG - Intronic
1132259741 15:100412324-100412346 GGGTGCCAAGACCATTCAATGGG - Intronic
1133452471 16:5915301-5915323 TAGAGTCAAGATAATTCAACTGG + Intergenic
1134268718 16:12715061-12715083 GGGCGCCAAGACAATTCAATGGG - Intronic
1134654223 16:15935297-15935319 GTGTGCTAAGACAATTCAATGGG + Intergenic
1134873532 16:17675159-17675181 AGGTGCCAAAATAATTTAATGGG - Intergenic
1135264165 16:21007963-21007985 TGGTGCCAAGATGATTAAATAGG - Intronic
1135542368 16:23341191-23341213 AGGTGCCAAGACAATTAAATGGG + Intronic
1135583322 16:23646979-23647001 GAGTGCCAAGACCATTCAACAGG - Intronic
1135601560 16:23788155-23788177 CAGTGCCAATTAAGTTCAATTGG + Intergenic
1135710442 16:24712017-24712039 GACTGCCAAGACCATTCAATGGG + Intergenic
1135877955 16:26222098-26222120 CAGTTCTATGATAAATCAATTGG + Intergenic
1136018299 16:27421074-27421096 GGGTGCCAAAACAATTCAATGGG - Intronic
1137297099 16:47105216-47105238 GGGTGCCAAGACCATTCAATAGG + Intronic
1137730884 16:50688780-50688802 GGATGCCAAGATAATTCAAAGGG - Intergenic
1138005803 16:53336352-53336374 GAGTGCCAAGACAATTCAATGGG + Intergenic
1138042532 16:53688921-53688943 TACTGCCAAAATAATACAATTGG - Intronic
1138486340 16:57346845-57346867 GAGTGCCAAGATAATTCAATGGG + Intergenic
1138901877 16:61281497-61281519 CCGTGCCAAGACTGTTCAATGGG - Intergenic
1139499565 16:67351144-67351166 CAGTGCCAAGCTAATCCACAAGG - Intronic
1139807675 16:69582623-69582645 GAGTGCCAAGACCATTCAATGGG - Intronic
1140009224 16:71113985-71114007 CAGGGCCAAGATACCTAAATTGG - Intronic
1140171195 16:72606793-72606815 AAGTGCCAAGATAATTCAATGGG + Intergenic
1141061025 16:80870483-80870505 AAGTTCCAATTTAATTCAATGGG + Intergenic
1143148727 17:4793759-4793781 GGGTGCCAAGATCATTCAATGGG + Intergenic
1144387021 17:14757699-14757721 AATTACCAAGATAATTCACTGGG - Intergenic
1144636765 17:16915021-16915043 AAGTGCCAAGATCATTCAATGGG + Intergenic
1146027910 17:29338709-29338731 ATGTGCCAAGATGATTCAATGGG + Intergenic
1146040989 17:29454186-29454208 GGATGCCAAGACAATTCAATGGG - Intronic
1146139592 17:30353609-30353631 GGGTGCCAAGACCATTCAATGGG - Intergenic
1146147643 17:30435386-30435408 GGATGCCAAGACAATTCAATAGG + Intronic
1146600243 17:34208260-34208282 GGGTGCCAAGATAATTCAATGGG - Intergenic
1146875031 17:36402708-36402730 AAGTGCCAGGATCATTCAGTGGG - Intronic
1147064357 17:37910162-37910184 AAGTGCCAGGATCATTCAGTGGG + Intergenic
1147128434 17:38390187-38390209 AGATGCCAAGACAATTCAATGGG - Intronic
1149353940 17:55819896-55819918 GAGTATCAAGAAAATTCAATGGG + Intronic
1150073984 17:62176791-62176813 AAGTGCCAAAATAATTCAATAGG + Intergenic
1150817541 17:68404948-68404970 GGGTGCCAAGACCATTCAATGGG - Intronic
1150921092 17:69483821-69483843 GAGTGCCAAGACAATTCAGGGGG + Intronic
1151426130 17:74032221-74032243 CAGGGACAAGATATTTCAACGGG - Intergenic
1151503360 17:74507283-74507305 AAGTGCCAAGAACATTCACTGGG - Intergenic
1152147729 17:78578814-78578836 AGGTGCCAAGACAACTCAATGGG + Intergenic
1152582883 17:81175662-81175684 GGGTGCCAAGACCATTCAATGGG + Intergenic
1152832656 17:82508019-82508041 TAGTGCCAAGGTTGTTCAATAGG - Intergenic
1153321005 18:3774268-3774290 TAGTGACAAGGTAATTCAAGAGG + Intronic
1153825725 18:8872676-8872698 GGGTGCCTAGATAACTCAATGGG - Intergenic
1153845392 18:9044825-9044847 AGGTGCCAAGATTATTCAGTGGG + Intergenic
1153870551 18:9315667-9315689 AAGTGCCAATGAAATTCAATGGG + Intergenic
1154003056 18:10501329-10501351 GCATGCCAAGATCATTCAATGGG - Intergenic
1154233206 18:12577021-12577043 AAGTGCCAAGGTAGTTCAATGGG + Intronic
1154972666 18:21426465-21426487 CAGTGCCAAGAAAATTCAAGGGG - Intronic
1155221260 18:23688321-23688343 GGGTGCCAAGACTATTCAATGGG - Intergenic
1155406923 18:25499022-25499044 ACGTGCCAAGTCAATTCAATGGG + Intergenic
1156210813 18:34940230-34940252 AGGTGCCAACATAATCCAATGGG + Intergenic
1156293257 18:35768439-35768461 TGGTGCCAAGAAAATTCAATGGG - Intergenic
1156432745 18:37092913-37092935 CAGTGCCTGAATAAATCAATGGG + Intronic
1156966828 18:43104654-43104676 CAGTCCTAAGATAATTATATTGG + Intronic
1157235164 18:45958545-45958567 GAATGCCAAAACAATTCAATGGG + Intronic
1157686778 18:49649172-49649194 AAGTGCCAAGACAAGTCAATAGG + Intergenic
1157769279 18:50331198-50331220 AGTTACCAAGATAATTCAATGGG - Intergenic
1157791854 18:50539489-50539511 AGGTCCCAAGGTAATTCAATAGG - Intergenic
1157961818 18:52162673-52162695 GGGTACCAAGTTAATTCAATGGG - Intergenic
1158746981 18:60212404-60212426 ATGTGCCAAGATAATCCACTGGG - Intergenic
1158897394 18:61927853-61927875 CCTTGCCCAGATAAGTCAATTGG + Intergenic
1159701062 18:71628301-71628323 GAGTGCCAAGAAAATTCAATGGG + Intergenic
1160252548 18:77215877-77215899 AAATGCCAAGATAATTCAATGGG - Intergenic
1161749694 19:6086196-6086218 GGGTGCCAAGATCATTCGATGGG - Intronic
1162240552 19:9350080-9350102 GAGTGCCAAGACAATTCAATGGG - Intronic
1163056457 19:14723187-14723209 GGGTGCCAAGACCATTCAATGGG - Intronic
1163147781 19:15393059-15393081 AGATGCCAAGATCATTCAATGGG + Intronic
1163199799 19:15758912-15758934 TGGTGCCAAGAATATTCAATGGG - Intergenic
1163383440 19:16984077-16984099 GGGTGCCAAGACCATTCAATGGG + Intronic
1163825634 19:19522892-19522914 AGGTGCCAAGATAATTCAATGGG - Intronic
1164471605 19:28541081-28541103 AGCTGCCAAGGTAATTCAATAGG + Intergenic
1164786947 19:30940977-30940999 AGGTGCCAGGGTAATTCAATGGG - Intergenic
1165191953 19:34071661-34071683 GGGTGCCAAGACCATTCAATGGG + Intergenic
1165597073 19:37018470-37018492 GGGTGCCAAGATCAGTCAATGGG + Intronic
1165638051 19:37360189-37360211 AGGTGCCAAGGTAATTCAATGGG - Intronic
1165876370 19:39010372-39010394 CGGTGCCAAGACCATTCAGTGGG - Intronic
1166050953 19:40259127-40259149 AGATGCCAAGATCATTCAATGGG + Intronic
1166272532 19:41724234-41724256 CGGTGCCAAGACCATTTAATGGG - Intronic
1166405280 19:42517057-42517079 GGGTGCCAAGATCATTCAGTGGG + Intronic
1166417161 19:42604160-42604182 GAGTGTCAAGATAATTTAATGGG - Intronic
1166430904 19:42727005-42727027 GTGTGCCAAGATCGTTCAATGGG + Intronic
1166443919 19:42842340-42842362 GTGTGCCAAGATCGTTCAATGGG + Intronic
1166451362 19:42905008-42905030 GTGTGCCAAGATCGTTCAATGGG + Intronic
1166456664 19:42947098-42947120 GAGTGCCAAGACCATTCCATGGG + Intronic
1166463602 19:43013004-43013026 GTGTGCCAAGATCATTCAATGGG + Intronic
1166466620 19:43037962-43037984 GAGTGCCAAGACCATTCCATGGG + Intronic
1166469753 19:43069581-43069603 GTGTGCCAAGATCATTCAATGGG + Intronic
1166472756 19:43094048-43094070 GAGTGCCAAGACCATTCCATGGG + Intronic
1166480888 19:43173099-43173121 GTGTTCCAAGATCATTCAATGGG + Intronic
1166486413 19:43217592-43217614 GAGTGCCAAGACCATTCCATGGG + Intronic
1166493528 19:43281019-43281041 GAGTGCCAAGACCATTCCATGGG + Intergenic
1166969364 19:46553801-46553823 GAGTGCCAAGATCATTTAATGGG - Intronic
1168583493 19:57574827-57574849 CGGGCCCAAGATAATGCAATTGG + Intronic
925249150 2:2415703-2415725 CAGTGCCAAAACAATGAAATAGG + Intergenic
926044940 2:9703490-9703512 CAGTGCCAAGAGACATCAGTGGG - Intergenic
926129655 2:10294447-10294469 AGATGCCAAGACAATTCAATGGG - Intergenic
926449071 2:12980480-12980502 AAGTGCCAAGCTAATTTAATTGG + Intergenic
926531979 2:14059271-14059293 ATGTGCCAAGAAAATTCGATAGG + Intergenic
926835705 2:17017508-17017530 ATATGCCAAGATAATTCAGTAGG - Intergenic
926903481 2:17783722-17783744 GAGTGCCAAGACAATTCAATGGG + Exonic
927421587 2:22938390-22938412 AGATGCCAAGGTAATTCAATTGG + Intergenic
927823884 2:26293664-26293686 CAGTGCCAAGACCATTCATGGGG + Intergenic
927953264 2:27188890-27188912 GGGTGCCAAGACAATTGAATGGG + Intergenic
927984418 2:27398232-27398254 TGATGCCAAGATAATTCAATGGG + Intronic
928050068 2:27983236-27983258 GGGTGCCAACACAATTCAATGGG - Intronic
928151462 2:28833593-28833615 GGGTGCCAAGAAAATTCAATGGG + Intronic
928589282 2:32797495-32797517 GGGTGCCAAGACTATTCAATGGG + Intronic
928698590 2:33875908-33875930 GGGTGCCAAGATAATTCAGTGGG - Intergenic
928995075 2:37280502-37280524 GAGTGTCAAGAAAATTCAACGGG + Intronic
929384746 2:41392868-41392890 GGGTGCCAAGATCATTCAAGGGG - Intergenic
929616191 2:43310466-43310488 GGGTGCCATGACAATTCAATGGG + Intronic
929906741 2:46052879-46052901 GAGTACCAAGACCATTCAATGGG + Intronic
930462528 2:51701098-51701120 CAGAGCCAAGATACGTCCATAGG - Intergenic
930662917 2:54073113-54073135 CGGCGCTAAGACAATTCAATGGG + Intronic
930812301 2:55555325-55555347 GAGTGCCAAGACAATTTGATGGG - Intronic
931896676 2:66739397-66739419 GGGTGCCAAGACAATTCAATGGG - Intergenic
932085942 2:68761114-68761136 GGGTGCCACGATAATTTAATGGG + Intronic
932170110 2:69547026-69547048 GGGTGCCAAGACAATTCAATGGG + Intronic
932557501 2:72838002-72838024 GAGTGACAAGATAATTCAATAGG - Intergenic
932630299 2:73336230-73336252 GGCTACCAAGATAATTCAATGGG + Intergenic
932652670 2:73576083-73576105 GAGTGCCAAGAACATTCAATGGG - Intronic
932704525 2:74012945-74012967 GAATGCAAAGACAATTCAATAGG - Intronic
932882918 2:75520572-75520594 GGGTGCCAAGACCATTCAATGGG + Intronic
932962463 2:76430003-76430025 CAGAGTCAAGAAGATTCAATGGG + Intergenic
933267379 2:80196468-80196490 CAGTGCCAAGAGATTAAAATAGG - Intronic
933413414 2:81953087-81953109 AGGTGCCAAGACAATTCAATGGG + Intergenic
933511881 2:83250150-83250172 CTGTGCAAAAACAATTCAATGGG + Intergenic
933643562 2:84790139-84790161 AGGTGCCAAGGCAATTCAATGGG + Intronic
933673377 2:85030599-85030621 GAGTGCCAAGACAATGCATTGGG - Intronic
933855451 2:86409547-86409569 GAGTGCCAAGATCATTTAATGGG + Intergenic
933863417 2:86493489-86493511 GAGTGCCAAGACCATTCAATGGG - Intergenic
933920175 2:87038027-87038049 GGGTGCCAAGACAATTCAACAGG + Intergenic
933931449 2:87155759-87155781 GGGTGCCAAGACAATTCAACAGG - Intergenic
934002823 2:87731866-87731888 GGGTGCCAAGACAATTCAACAGG - Intergenic
934505095 2:94884163-94884185 GGGTGCCAAGATTATTCAGTGGG - Intergenic
934776669 2:96942873-96942895 GGGTGCCAACAGAATTCAATAGG + Intronic
934878237 2:97947907-97947929 GGGTGCCAAGGCAATTCAATTGG + Intronic
934995462 2:98954240-98954262 CAACGTCAAGATAATTCAATAGG + Intergenic
935030349 2:99315755-99315777 AAGTTCCAAGACAATTCAAATGG - Intronic
935052774 2:99537529-99537551 GGGTGCCAAGAAAATTCAATGGG + Intergenic
935195442 2:100812021-100812043 AAGTACCAAGACAATTCAATGGG - Intergenic
935519613 2:104088186-104088208 AAGTGCCAAGATGATTTAATGGG - Intergenic
935613490 2:105051309-105051331 AAGTGATAAAATAATTCAATGGG - Intronic
935728855 2:106048026-106048048 AGGTGCCAAGATAATTTAGTGGG - Intergenic
935741839 2:106155789-106155811 GGGTGCCAGGAAAATTCAATGGG + Intronic
936242896 2:110803395-110803417 CAGAGCCAAGACAATTCAATGGG + Intronic
936361671 2:111809680-111809702 GGGTGCCAAGACAATTCAACAGG + Intronic
936936443 2:117842938-117842960 CAGTGCCAAGACCATTCTATGGG - Intergenic
937135826 2:119551522-119551544 GAGGGCCAAGACCATTCAATGGG - Intronic
937327351 2:120998722-120998744 AAGTGCCAAGGCAATTCAATAGG + Intergenic
937749949 2:125463581-125463603 ATGTGCCAAGATAAATAAATGGG + Intergenic
937932178 2:127215247-127215269 GAGTTCCAAGATCTTTCAATAGG + Intronic
937992036 2:127669143-127669165 GAGTGCCAAGACCATTCAATGGG + Intronic
938068876 2:128297251-128297273 TGGTGCCAAGACCATTCAATGGG + Intronic
938136237 2:128759332-128759354 GAGTACCAAGATCATTCAGTGGG - Intergenic
938770044 2:134493882-134493904 AGGTGCCAAGGTAATTCAATGGG - Intronic
938818700 2:134931341-134931363 CAATCCCAAGAAAATTCAGTGGG - Intronic
938844285 2:135192757-135192779 GGGTGCCAAGATCATTCAATGGG + Intronic
938877083 2:135543235-135543257 CAGTGCCAAGACAATTCAATGGG - Intronic
939368982 2:141273455-141273477 GGGTGCCAAGAAAGTTCAATGGG + Intronic
939385052 2:141485447-141485469 CAGTGCTAGGATATTTCAGTTGG + Intronic
940137313 2:150452544-150452566 TAGTGCCAAAACCATTCAATAGG - Intergenic
940364475 2:152832574-152832596 CAGTGTCAAGACCATACAATAGG - Intergenic
940920464 2:159299880-159299902 TGGTGCCAAGACAATTCAACGGG - Intergenic
940942078 2:159573389-159573411 GGGTGCCAAAACAATTCAATGGG + Intronic
940952821 2:159695645-159695667 GAATGCCAAGGTAATTCAATGGG - Intergenic
941510306 2:166399603-166399625 GAGTGTCAAGACAATTGAATGGG + Intergenic
941742463 2:169049588-169049610 GAGCGCCAAGATCATTCAACAGG + Intergenic
942180530 2:173376412-173376434 GGGTGCCAAGAGCATTCAATGGG - Intergenic
942365115 2:175217992-175218014 GAGTGACAAGACAATTCAACGGG + Intergenic
942365747 2:175224889-175224911 AGGTGCCTAGACAATTCAATGGG - Intergenic
942894542 2:181036291-181036313 AAATGCCAAGGTAATTCAGTAGG + Intronic
943550619 2:189334950-189334972 AGGTGTCAAGATAATTTAATAGG + Intergenic
943931959 2:193866307-193866329 AGGTGCCAAGAGCATTCAATAGG - Intergenic
943974362 2:194452438-194452460 AGATGCCAAGATACTTCAATGGG - Intergenic
944009138 2:194951895-194951917 GAGTGCCAAGATAATGAAATGGG + Intergenic
944418465 2:199502823-199502845 GGGTGCCAAGACAACTCAATGGG + Intergenic
944457028 2:199905885-199905907 AAGTGCCAAGATAATTCAATGGG - Intergenic
944484311 2:200188447-200188469 GCATGCCAAGACAATTCAATGGG + Intergenic
944508040 2:200435027-200435049 AGGTACCAAGACAATTCAATGGG + Intronic
944638222 2:201695388-201695410 CAGTGACATGATAGTTCAGTGGG - Intronic
944722540 2:202438727-202438749 GGGTGCCAAGACAATTCAATGGG - Intronic
944976514 2:205059196-205059218 TGGTGCCAAGACCATTCAATGGG - Intronic
945108451 2:206339908-206339930 GGATGCCAAGATCATTCAATGGG - Intergenic
945202973 2:207303096-207303118 CAATGCCGAGACAATTCAATTGG + Intergenic
945237805 2:207648485-207648507 AGGTGCCAAGAGAATTCAATGGG + Intergenic
945905842 2:215592436-215592458 GAGTGGCAAGATAATTCATGGGG - Intergenic
946761186 2:222994830-222994852 AAGAGCCAAGATAATGCAAAGGG - Intergenic
947014469 2:225602724-225602746 AACTGCCAAGATCATTCACTGGG - Intronic
947071900 2:226297601-226297623 GGGTGCCAAGACAAGTCAATAGG + Intergenic
947299462 2:228672851-228672873 GAGCACCAAGACAATTCAATGGG - Intergenic
947911799 2:233805793-233805815 GGGTGCCAAGACAATTCAGTGGG + Intronic
948331814 2:237173981-237174003 GGGTACCAAGATGATTCAATGGG - Intergenic
948442675 2:238005669-238005691 AGGTGCCAAGGTAAGTCAATGGG - Intronic
948579334 2:238973334-238973356 AAATGCCAAGATAATTCATGAGG + Intergenic
948579658 2:238976745-238976767 AAGTGCCAAGATAATTCAATGGG + Intergenic
1169038646 20:2474659-2474681 GGGTGCCAAGATTATTCAGTGGG - Intronic
1169164640 20:3411874-3411896 GGGTACCAAGACAATTCAATGGG - Intergenic
1169237147 20:3939461-3939483 GGGTGCCAAGACAATTCAGTGGG - Intronic
1169237342 20:3941748-3941770 CACTTCAAATATAATTCAATGGG + Intronic
1169238713 20:3955396-3955418 GGGTGCCAAGATCATTCAATGGG - Intronic
1169949272 20:11025195-11025217 GGGTGCCAAGACAATTCAATAGG - Intergenic
1170048935 20:12119215-12119237 GAGTGCCAAGAATATACAATGGG + Intergenic
1170273655 20:14557099-14557121 GAGTGCCAAGACAATTCAATGGG + Intronic
1170563873 20:17582577-17582599 GAGTGCCAGGATAATTCAGTTGG + Intronic
1170637872 20:18124333-18124355 GGGTGCTAAGATCATTCAATTGG + Intergenic
1170777877 20:19394082-19394104 GAGTTCCAAGACTATTCAATGGG + Intronic
1171397990 20:24851277-24851299 ATGTGCCAAGGTAATCCAATAGG + Intergenic
1171435827 20:25123537-25123559 GTGTGCCAAGAACATTCAATGGG + Intergenic
1171892762 20:30730928-30730950 GGGTGCCAAGATTATTCAGTGGG - Intergenic
1172173035 20:32954393-32954415 AAGTGCCAAGACCACTCAATTGG - Intronic
1172866606 20:38104525-38104547 CAGTGCCAGGACTCTTCAATGGG + Intronic
1172961518 20:38803912-38803934 GAGTGCCAAGACAATTTAATGGG - Intergenic
1173238721 20:41273619-41273641 CAGTGCCAAGATGATTCACTGGG - Intronic
1174237832 20:49108592-49108614 GGGTGCCAAGACCATTCAATGGG + Intergenic
1174727856 20:52882249-52882271 AAGTGCCAAGATAATTCAGTGGG - Intergenic
1175629512 20:60522996-60523018 GGGAGCCAAGATCATTCAATGGG + Intergenic
1176621041 21:9061721-9061743 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1177165371 21:17596547-17596569 AAGTGCCAAAGCAATTCAATGGG - Intronic
1177456668 21:21348811-21348833 AAGTGCCAAGAATATACAATAGG + Intronic
1177535213 21:22417768-22417790 CAGTGCCAAGCCTATTCAATGGG - Intergenic
1177575209 21:22945273-22945295 CAGAGCCTAGAAAATTCAAGAGG + Intergenic
1177795511 21:25774692-25774714 AGGTGCCAAGGTAATTCAATAGG + Intergenic
1177813059 21:25945664-25945686 TAGTGCCAAGACCATTCAATGGG + Intronic
1178101781 21:29277636-29277658 AAGTGCCAAAGTAAATCAATGGG + Intronic
1179009381 21:37544226-37544248 AGGTACCAAGGTAATTCAATGGG + Intergenic
1179074421 21:38106542-38106564 CTGTACCAAGACAATTAAATGGG + Intronic
1179193975 21:39147814-39147836 AGGTGCCAAGGTAATTCAACAGG - Intergenic
1179434832 21:41353535-41353557 CAGTGCCAAGATTATTTAATGGG + Intronic
1180191172 21:46163611-46163633 GAGTGCCAAGACAATTCAGGAGG - Intronic
1180895057 22:19325052-19325074 GGGTGCCAAGACCATTCAATGGG + Intergenic
1182513270 22:30835396-30835418 GGGTGCTAAGATAATTAAATGGG - Intronic
1182668895 22:31979383-31979405 GGGTGCCAAAAAAATTCAATGGG - Intergenic
1182817860 22:33182453-33182475 GGATGCCAAGACAATTCAATAGG + Intronic
1184013677 22:41769289-41769311 GGATGCCAAGATAATTCAATGGG + Intronic
1184053312 22:42025584-42025606 GAATGCCAAGACCATTCAATGGG - Intronic
1184439907 22:44503725-44503747 GGGTGCCAAGACAGTTCAATGGG + Intergenic
1184905132 22:47477858-47477880 GGGTGCCAAGACAATTCAGTGGG - Intronic
1184905352 22:47481343-47481365 CAATCCCAAGAAAAATCAATGGG + Intronic
1184983280 22:48111073-48111095 CCGTGCCAAGACCATTCACTAGG + Intergenic
1185239089 22:49732170-49732192 GGGTGCCAAGACCATTCAATAGG - Intergenic
1185412327 22:50690082-50690104 GGGTGCCAAGACCATTCAATGGG - Intergenic
949686844 3:6583858-6583880 AAGTGTCATGGTAATTCAATGGG - Intergenic
949796262 3:7854617-7854639 CTGTGCCAAGATACCTTAATAGG - Intergenic
950208742 3:11101180-11101202 GGGAGCCAAGAAAATTCAATGGG - Intergenic
950598119 3:14003825-14003847 AAGTGTCAAGACAATTCCATGGG - Intronic
950735002 3:14999769-14999791 AGGTGCCACGATAATTCAATAGG - Intronic
950828411 3:15850111-15850133 AGATGCCAAGACAATTCAATGGG + Intronic
951616613 3:24553696-24553718 GGGTGCCATGATAATTCAATGGG - Intergenic
951719546 3:25683392-25683414 GGGTGCCAAGATCATTCAATAGG + Intergenic
951793755 3:26515824-26515846 AAGTGCCAAGAACATTCACTGGG - Intergenic
951858122 3:27220898-27220920 TAATGACAAGAAAATTCAATAGG + Intronic
952246306 3:31596386-31596408 CAGTGCCAAACCAGTTCAATGGG - Intronic
952318157 3:32250137-32250159 GAGTGCCAAGATAATTCAATGGG - Intronic
953008643 3:39002070-39002092 GTGTGCCAAGACTATTCAATGGG - Intergenic
953313607 3:41905205-41905227 GGGTTCCAAGACAATTCAATGGG + Intronic
953585051 3:44192160-44192182 GAGTGCCAAGATAAAGCACTTGG + Intergenic
954287929 3:49632051-49632073 GAGTGCCAAGACCATTCAGTAGG + Intronic
954477138 3:50757851-50757873 AGGTGCCAAGACAATTCAACAGG - Intronic
954724449 3:52595906-52595928 CAGTGCCAAGAATATACATTGGG - Intronic
955293003 3:57710147-57710169 CAGTGCTGAGACCATTCAATGGG + Intergenic
955304103 3:57812336-57812358 GGGTGCCAAGATCATTTAATGGG - Intronic
955646620 3:61145303-61145325 AAGAACCAAGACAATTCAATAGG - Intronic
955946744 3:64201998-64202020 GGGTACCAAGACAATTCAATGGG - Intronic
956462810 3:69488460-69488482 AGGTGCCAAGTCAATTCAATAGG + Intronic
956988655 3:74735665-74735687 AAGTGTCAAGGTAACTCAATTGG - Intergenic
957016686 3:75072257-75072279 AATTTCCAAGATAAGTCAATTGG + Intergenic
957727147 3:84082248-84082270 AACTGCCAAGATAGTTAAATAGG - Intergenic
957755826 3:84485937-84485959 AAGTGCCAAGAACATACAATGGG - Intergenic
957964146 3:87300595-87300617 AAGTGTTAAGATAATTCAAGAGG + Intergenic
958252586 3:91287772-91287794 AGGTGCCAAAATAATTCAGTGGG + Intergenic
958807364 3:98827952-98827974 GGGTGCCTAGACAATTCAATGGG + Intronic
959028621 3:101271660-101271682 CAGGGGCAATGTAATTCAATGGG - Intronic
959851427 3:111092561-111092583 GAGTACCAAGTCAATTCAATGGG - Intronic
960077239 3:113501136-113501158 GAGTTCCAAGATCATTCAATGGG + Intronic
960077819 3:113508008-113508030 GGGTGCCAAGACAATTCAACGGG + Intronic
960646906 3:119895673-119895695 GGATTCCAAGATAATTCAATGGG - Intronic
960662018 3:120070822-120070844 CAGTGCCAACGTAGTTCAAAAGG + Intronic
960881031 3:122345131-122345153 GGGTGCCAAGATAATTCGATGGG - Intergenic
961387730 3:126532534-126532556 GGGAGCCAAGACAATTCAATGGG - Intronic
961401483 3:126648570-126648592 GGGTGCCAAGACCATTCAATGGG + Intronic
961409671 3:126710209-126710231 AGGTTCCAAGATAATTCAATGGG - Intronic
961710055 3:128821213-128821235 GGGTGCCAAGACCATTCAATGGG + Intergenic
962347911 3:134634468-134634490 AAGTGCAAAGACAATTCAGTTGG + Intronic
962433331 3:135341127-135341149 GAGTACCAAGATAATTCAATGGG + Intergenic
962529777 3:136268290-136268312 ATGTGTCAAGACAATTCAATGGG - Intronic
962595378 3:136937228-136937250 TGGTGCCAAGATCACTCAATGGG - Intronic
962668523 3:137680880-137680902 AAGTGCCAAGAACATACAATGGG + Intergenic
962871819 3:139502920-139502942 AAGTGCCACTATGATTCAATGGG + Intergenic
963180036 3:142345252-142345274 GGGTGCCAAGACTATTCAATGGG + Intronic
963180040 3:142345273-142345295 GGGTGTCAAGAAAATTCAATGGG + Intronic
963242344 3:143019546-143019568 AAGTGCCAACATAATTTAATAGG - Intronic
963257792 3:143163106-143163128 AGGTGCCAAGTTAGTTCAATGGG + Intergenic
963731954 3:148983254-148983276 TCGTGCCAAGACAATTCAGTGGG + Intergenic
963879849 3:150516775-150516797 GGGGGCCAAGACAATTCAATGGG + Intergenic
964278632 3:155036990-155037012 AGGTGCCAAGGCAATTCAATGGG - Intronic
964440633 3:156705124-156705146 CAGTACCAAGATTTTTCAAATGG - Exonic
964537662 3:157742119-157742141 AAATGCCAGGATAATTCAATGGG + Intergenic
964725617 3:159811549-159811571 AGGTGCCAAGGTAATTCAATGGG - Intronic
964788196 3:160422912-160422934 GGATGCCAAGAAAATTCAATGGG - Intronic
965611820 3:170552216-170552238 TAGTGTCAAGACAATTCAATAGG + Intronic
965744537 3:171910562-171910584 GAGTGTCAAGATTATTCAATGGG - Intronic
965923998 3:173955228-173955250 CCGTGCAAAAATAAGTCAATGGG + Intronic
966364727 3:179173225-179173247 AGGTGCCAAGGTAATTCAATGGG + Intronic
967004087 3:185367192-185367214 GGGTGCCAAGACAATTTAATGGG - Intronic
967352482 3:188529099-188529121 CAGAGGGAAGATAATTCAAAAGG - Intronic
967455348 3:189679881-189679903 AAGTGCCAAGAACATACAATAGG - Intronic
967618022 3:191597093-191597115 AAATGCCAAGGCAATTCAATAGG - Intergenic
967619604 3:191617088-191617110 GGGTGCCAAGACAGTTCAATAGG + Intergenic
967906265 3:194503046-194503068 GGGTGCCAAGACAATTCAATGGG + Intergenic
968543805 4:1185033-1185055 AAGTGCCAAGACCATTCAATGGG + Intronic
968580339 4:1387706-1387728 TGGTGCGAAGATAATTCAATGGG - Exonic
969372059 4:6738473-6738495 AAGTGTCAAGACCATTCAATGGG - Intergenic
969434193 4:7175425-7175447 AAGTGCCAAAACAATTCAATGGG - Intergenic
969553581 4:7890254-7890276 AGATGCCAAGATAATGCAATGGG + Intronic
969699149 4:8756698-8756720 CGGTGCAAAGGCAATTCAATAGG + Intergenic
970411386 4:15811539-15811561 GAGTGCCAAGGCCATTCAATGGG - Intronic
971023157 4:22559069-22559091 GGGTGCCAAGACAATTCAATGGG - Intergenic
971229164 4:24784879-24784901 CAGTGCCAAGGTAATTTAATGGG - Intergenic
971285284 4:25283254-25283276 AGGTGCCAAGGCAATTCAATGGG + Intergenic
971291084 4:25340264-25340286 TGGTACCAAGACAATTCAATGGG - Intronic
971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG + Intergenic
971585910 4:28405438-28405460 CAGTGCCAAGAACACTCAACAGG - Intergenic
971804998 4:31345795-31345817 TAATTCCAAGATCATTCAATGGG + Intergenic
972127455 4:35787562-35787584 GGGTGCCAAGACAATACAATGGG + Intergenic
972551434 4:40138668-40138690 GAGTGCCAAGAAAATTCAATGGG - Intronic
972616958 4:40708253-40708275 CAGTGTCAAGATCATCCAAAGGG + Intergenic
972626407 4:40803825-40803847 GGGTGCCAAGACCATTCAATAGG - Intronic
972761431 4:42109031-42109053 GAGTGCCAGGACAATTCAATGGG - Intergenic
972955514 4:44385427-44385449 AAGTGCCAACACTATTCAATGGG + Intronic
972968071 4:44537256-44537278 CAGTGTAAAGGCAATTCAATAGG + Intergenic
973050933 4:45595419-45595441 AATTCCCTAGATAATTCAATTGG - Intergenic
973911740 4:55588747-55588769 GAGTGCCAAGACCATTAAATGGG - Intronic
973977568 4:56278383-56278405 GAGTGCTAAGACAATTCAATGGG + Intronic
974008214 4:56581897-56581919 GAGTGTCAAGATAGTTTAATGGG + Intronic
974029861 4:56766895-56766917 AACTGCCAAGACAATTCAATGGG + Intergenic
974181598 4:58390474-58390496 AGGTGCCAAGACCATTCAATAGG - Intergenic
974205111 4:58691906-58691928 CAGTGCCAAGGTAATTCAATGGG + Intergenic
975276735 4:72511002-72511024 AAGTGCCAAGAACATACAATGGG + Intronic
975391646 4:73825049-73825071 GGGTGCCAAGATAAATAAATGGG - Intergenic
975636465 4:76454424-76454446 GAGTGCCAAGATCATTCAGTAGG - Intronic
975688419 4:76941430-76941452 AAGTGCCAAGATAATTCTATGGG - Intergenic
976083396 4:81381450-81381472 CAGTGTCAAGATTTTTCGATGGG - Intergenic
976516488 4:85973788-85973810 GAGTGCCAAGAAAATCTAATGGG - Intronic
976727050 4:88224951-88224973 AGGTGCCAAGACCATTCAATGGG - Intronic
976800367 4:88984029-88984051 GAGTGCTGAGATAATTCAATGGG + Intronic
977016969 4:91702863-91702885 GAGTGCTAAGACCATTCAATGGG - Intergenic
977039335 4:91995310-91995332 CATTACGAAGACAATTCAATGGG + Intergenic
977086952 4:92612228-92612250 AAGTGCCAAAATAATTCAACAGG - Intronic
977193281 4:94026916-94026938 TGGTGCCAAGACCATTCAATGGG + Intergenic
977203014 4:94139245-94139267 AGGTGCCAAGACAATTCAACAGG + Intergenic
977218900 4:94315261-94315283 CAGTTCCAAGATGACTGAATAGG - Intronic
977398545 4:96501947-96501969 AAGTGCCAAGAATATTCACTGGG + Intergenic
977468816 4:97415775-97415797 GGGTGCCAAGAAAATTCAATGGG - Intronic
977664302 4:99627434-99627456 GGATGCCAAAATAATTCAATGGG - Intergenic
977921972 4:102655525-102655547 CAGGGCCAAAAGAATTTAATGGG + Intronic
978253610 4:106665128-106665150 ATGTGGCAAGATAATTCAATGGG - Intergenic
978258958 4:106728948-106728970 GAGTGCCAAGACCATTCAATGGG + Intergenic
979420518 4:120499609-120499631 ATGTACCAAGATAATTCAATGGG - Intergenic
979488454 4:121296082-121296104 AGGTGCCAAGAAAATACAATGGG + Intergenic
979590070 4:122468402-122468424 GGGTGCCAAGACAATTCAGTGGG + Intergenic
979781470 4:124656304-124656326 AAATGCCAAAGTAATTCAATGGG + Intergenic
979887682 4:126050202-126050224 GAGTGCTGAGATAATTCAATGGG - Intergenic
979996075 4:127432560-127432582 GTGTACCAGGATAATTCAATGGG + Intergenic
980634762 4:135487007-135487029 AAATGCTAAGAAAATTCAATGGG - Intergenic
980723339 4:136725389-136725411 CAATGCCAACATGATTCAATTGG + Intergenic
980821222 4:138020181-138020203 GGGTGCCAAGACAATTCAATGGG + Intergenic
981185257 4:141794296-141794318 GAGTGTCAAGATTATACAATGGG - Intergenic
981999232 4:151007166-151007188 AAGTGCCAAGGTAATTCAATGGG + Intronic
982034083 4:151328230-151328252 GGGTGCCAACATAATTCAACAGG + Intergenic
982806361 4:159769711-159769733 AAGTGCCAAGGTAATTGTATTGG + Intergenic
983078934 4:163361191-163361213 CGGTACCAAGAGAATTCCATAGG - Intergenic
983178887 4:164623759-164623781 CAGTGGCAGGATAATTCTCTGGG - Intergenic
983246040 4:165288263-165288285 GAGTGCCAAGACCACTCAATGGG - Intronic
983655281 4:170076974-170076996 GGGTGCCAAGATCATTCAGTGGG - Intronic
983746125 4:171202633-171202655 CAGTGGCAAGTTTATTTAATTGG - Intergenic
984621231 4:181954976-181954998 AGGTGCTAAGGTAATTCAATGGG - Intergenic
984722159 4:182983572-182983594 AAGTGCCAAGGTAATCAAATGGG + Intergenic
985298626 4:188462713-188462735 GGGTGCCAAGAATATTCAATAGG + Intergenic
986714816 5:10515540-10515562 GAATGCCAAGACCATTCAATGGG + Intronic
986760195 5:10873050-10873072 AAATGCCAAGATAATTAAAAAGG - Intergenic
987179498 5:15352450-15352472 GTGTGCCAAGACCATTCAATGGG - Intergenic
987184562 5:15402461-15402483 GGGTGCCAATATCATTCAATGGG + Intergenic
987680432 5:21129535-21129557 CACTTCCAAGGTTATTCAATAGG - Intergenic
987796534 5:22635220-22635242 GATTGCCAAGAAAATTCAATGGG + Intronic
987909167 5:24119505-24119527 GTGTGCCAAAGTAATTCAATAGG + Intronic
988830839 5:34985744-34985766 GGGTGCCAAGACCATTCAATGGG - Intergenic
989390199 5:40892385-40892407 AAGTGCCAAGAATATTCAATGGG + Intergenic
989390327 5:40893994-40894016 CATGGCCAAGATAATTCCTTTGG - Intergenic
989416851 5:41188499-41188521 GGGTGCCAAGACAGTTCAATGGG + Intronic
989819801 5:45782714-45782736 AGCTGCCAAGATAATTTAATTGG - Intergenic
990479148 5:56190975-56190997 GAGTGCCAAGACCATTCAATAGG - Intronic
991018369 5:61955500-61955522 AAGTGCCAAGAACATTCACTGGG - Intergenic
991609647 5:68436867-68436889 CAGTGCCTGGATAATGGAATGGG + Intergenic
991908229 5:71534349-71534371 GGGTGCCAAGACTATTCAATGGG - Intronic
992598553 5:78371424-78371446 GTGTGCCAAGATCATTCAATGGG - Intronic
992600781 5:78397211-78397233 GAGTGTCAGGATAATCCAATGGG + Intronic
992650678 5:78856163-78856185 GGGTGCCAAGATAGTTCCATTGG - Intronic
992793137 5:80231689-80231711 TTCTGCCAAGATAATTCAACTGG + Intronic
992983013 5:82196654-82196676 GGGTGCCAAGATAATTAAGTGGG - Intronic
993662570 5:90656515-90656537 CAGTTGCCAGATAATTCAATAGG + Intronic
993680871 5:90875915-90875937 TAGTGCCAAAATAATTAAAATGG + Intronic
994654627 5:102575684-102575706 GGGTGCCAAGACAATTCAATGGG - Intergenic
995284655 5:110373969-110373991 AGGTGCCAAGGAAATTCAATGGG - Intronic
995636243 5:114194956-114194978 TGGTGCCAAGACAATTGAATGGG - Intergenic
995636297 5:114196057-114196079 GGGTGCCAAGACAATTGAATTGG - Intergenic
995649333 5:114350721-114350743 GGGTGCCTAGATAATTCATTGGG - Intergenic
995788140 5:115853721-115853743 AAGTACCAAGGCAATTCAATAGG - Intronic
995817219 5:116184709-116184731 CAGTTCCATGATAATTCTCTAGG + Intronic
995974360 5:118013724-118013746 CAGTGCTAAGATACTTCAGTGGG - Intergenic
996390657 5:122957281-122957303 GAGTGCCAAGATCATTCAAATGG - Intronic
996426816 5:123321792-123321814 AGGTGCCAAGACCATTCAATGGG - Intergenic
996645383 5:125808784-125808806 GACTGCCAAGACAATTCAAAGGG + Intergenic
997086085 5:130801334-130801356 AAGTGCCAAGAACATACAATGGG + Intergenic
997098998 5:130946885-130946907 CAGTGCCAAGACCACTCAATGGG + Intergenic
997164877 5:131649885-131649907 AAGTGCCAAGACCATTCAACAGG - Intronic
997760044 5:136436922-136436944 AAGTGCCAAGGTAATTCAATAGG - Intergenic
998211574 5:140203257-140203279 CATTGCAAAGATAATACAAATGG + Intronic
998410446 5:141906563-141906585 GGGTGCCAAGAGCATTCAATGGG + Intergenic
998926345 5:147130413-147130435 CAGTGGCAGGATAATTCTCTGGG + Intergenic
998943690 5:147313796-147313818 GGGTGCCAAGAAAATTCAATGGG + Intronic
999184498 5:149696309-149696331 GGGTGCCAAGACCATTCAATGGG + Intergenic
999442065 5:151609575-151609597 GGATGCCAAGACAATTCAATGGG - Intergenic
999566665 5:152870726-152870748 AAGTGTCAAAAGAATTCAATAGG + Intergenic
999746349 5:154595467-154595489 AGGTGCCAAGACCATTCAATGGG - Intergenic
999833439 5:155342470-155342492 CAGTGGGAAGAGAATGCAATTGG - Intergenic
1000034723 5:157436785-157436807 CGGTGCCAAGACCATTCAATAGG + Intronic
1000472417 5:161661423-161661445 GAATGCCAAGACCATTCAATAGG + Intronic
1001248789 5:170128351-170128373 GGGTGCCCAGATCATTCAATGGG + Intergenic
1001393333 5:171398452-171398474 GGTTGCCAAGATCATTCAATGGG - Intronic
1001509228 5:172307073-172307095 AGGTGCCAAGGCAATTCAATGGG + Intergenic
1002138435 5:177123137-177123159 GAGTGCCAAGACCATTCAAATGG + Intergenic
1002149570 5:177216599-177216621 CAGTGCCAAGACTACACAATGGG - Intronic
1003597268 6:7485388-7485410 GAGTGCCAAGATCATTCAGTGGG - Intergenic
1003702633 6:8486281-8486303 TGGTGCCAAGATCATTCAAGGGG + Intergenic
1004268458 6:14171709-14171731 GACTGCCAAGACAATTCAATAGG + Intergenic
1004859366 6:19785783-19785805 ATACGCCAAGATAATTCAATGGG + Intergenic
1005372456 6:25149590-25149612 AAGTGTCAAGACCATTCAATGGG + Intergenic
1005523421 6:26621541-26621563 GGGTGGCAAGAGAATTCAATGGG - Intergenic
1005596757 6:27386631-27386653 AAGTGCCAAGACCATTCAATGGG + Intronic
1006209238 6:32379842-32379864 GGGTGCCAAGACCATTCAATGGG + Intergenic
1007314174 6:40971295-40971317 GGGTGCTAAGAAAATTCAATGGG + Intergenic
1007854735 6:44844122-44844144 AGGTGCCAAGATAACTCAATAGG + Intronic
1009191893 6:60639150-60639172 AGGTGCCAAAATAATTCAGTGGG - Intergenic
1009304306 6:62068761-62068783 TAATGCCAAGATCATTCAATAGG - Intronic
1010313624 6:74419119-74419141 CAGTGCCAAGAACACTCACTGGG - Intergenic
1010875245 6:81096134-81096156 GAATGCCAAGACCATTCAATGGG - Intergenic
1010916060 6:81620621-81620643 GAGTGCCAGGACAATTCAACAGG - Intronic
1011920151 6:92564506-92564528 CACTGCCTAGATAATACATTTGG - Intergenic
1012266792 6:97154711-97154733 GAGTGCCAAGACAATTTAATTGG - Intronic
1012750892 6:103162352-103162374 TAGTGCCTAGATAAAACAATAGG - Intergenic
1013143969 6:107369043-107369065 AAGTGCCAAGACAATTCAATGGG + Intronic
1013331282 6:109103007-109103029 AAGTAACAAGGTAATTCAATTGG - Intronic
1013875095 6:114815847-114815869 GGGTGCCAAGATCATTCAATGGG - Intergenic
1014858001 6:126426610-126426632 TGATGCCAAGATAATTCAGTGGG + Intergenic
1015193253 6:130495392-130495414 AAGTGCCAAGGTAACTCAATGGG - Intergenic
1015432698 6:133149897-133149919 CAGTACCAAAATATTTCAAGTGG - Intergenic
1015661436 6:135579398-135579420 AAGTGTCAAGATAATTCAACAGG - Intergenic
1015998829 6:139022089-139022111 GAGTGCCAAGACCATTTAATGGG - Intergenic
1016116712 6:140295069-140295091 AAGTGCCAAGAATATACAATAGG + Intergenic
1016179675 6:141129606-141129628 AAGTGCCAAGGTAATGAAATAGG + Intergenic
1016294173 6:142556353-142556375 AAGTGCCAAGAACATTCATTGGG + Intergenic
1016398592 6:143653593-143653615 GGATGCCAAGACAATTCAATGGG + Intronic
1016421444 6:143888167-143888189 TGGTGCCAAGATTATTCAATGGG - Intronic
1016436048 6:144038554-144038576 GGATGCCAAGACAATTCAATGGG + Intronic
1016697400 6:147013700-147013722 TGGTGCCAAGGTAATTCAGTTGG + Intergenic
1017082128 6:150680131-150680153 TAGTGCCATGATCATTCAAATGG - Intronic
1017583320 6:155891610-155891632 GAATGCCAAGATAATTCAATAGG + Intergenic
1018789220 6:167133368-167133390 AGGTGCCAAGGTAACTCAATGGG - Intronic
1019456752 7:1131946-1131968 GAGTGCCATGACAATTCAGTGGG + Intronic
1019657826 7:2206554-2206576 AAGTGTCCAGATAATTCAGTGGG - Intronic
1019948728 7:4352464-4352486 GAATGCCAAGACCATTCAATGGG - Intergenic
1021966048 7:25919977-25919999 GAGCCCCAAGATCATTCAATGGG + Intergenic
1022170232 7:27820586-27820608 GAGAGCCAAGACAATTCAAGAGG + Intronic
1022249887 7:28596919-28596941 TAGGGCCAAGATAATACCATAGG + Intronic
1022387111 7:29911658-29911680 GGGTGCCAAGACCATTCAATAGG + Intronic
1022661586 7:32372367-32372389 GGGTACCAAGACAATTCAATGGG + Intergenic
1023246890 7:38214724-38214746 CAGTGACTAGATATGTCAATGGG - Intronic
1023288047 7:38639505-38639527 AAGTGCCAAGATCATTCAATGGG + Intergenic
1023392462 7:39723379-39723401 GGGTGCCAAAATAATTCAAAAGG + Intergenic
1023417228 7:39944960-39944982 AGGTGCCAAGACAATACAATGGG - Intergenic
1023893394 7:44411019-44411041 GAGTACCAAGACAATTCAATGGG + Intronic
1024014716 7:45302474-45302496 GGGTGCCAAGACCATTCAATGGG + Intergenic
1024171152 7:46788417-46788439 GAGTGCCAAGATAATTCAATAGG - Intergenic
1024216171 7:47250521-47250543 AAATGCCAAGACAATCCAATAGG + Intergenic
1024390229 7:48801834-48801856 TGGTGCTAAAATAATTCAATGGG + Intergenic
1024487984 7:49941986-49942008 GGATGCCAAGATCATTCAATGGG + Intronic
1024513647 7:50223705-50223727 CAGTGCCAACATTATTCATTTGG + Intergenic
1024539343 7:50463368-50463390 CAGTGCCAAAAAAATCCACTTGG - Exonic
1024622449 7:51173502-51173524 CACTGCCCAGCTAATTCATTGGG + Intronic
1024956901 7:54931845-54931867 CGGTGCCAAGAACATACAATGGG + Intergenic
1026020740 7:66703564-66703586 AGGTGTCAAGATCATTCAATGGG - Intronic
1026410882 7:70121073-70121095 GAGTGCCAAGACACTTCAATGGG + Intronic
1027511199 7:79082486-79082508 GAATGCCAAGATAATTCAATGGG - Intronic
1027589767 7:80103219-80103241 GAGTGACAAGACCATTCAATGGG - Intergenic
1027820647 7:83039474-83039496 GAGTGCCAAGAATATTCAGTAGG - Intronic
1027887395 7:83926808-83926830 CAGTGCCAAGAAAATTCAATGGG - Intergenic
1027989370 7:85336980-85337002 CAGAGACAAGGTAAATCAATTGG - Intergenic
1028815428 7:95138248-95138270 AAGTACCATGATAATTCCATTGG + Intronic
1029245696 7:99199472-99199494 AGGTACCAAGACAATTCAATGGG + Intronic
1029340292 7:99937430-99937452 GAGTGTCAAGACAATTCAGTCGG - Intergenic
1029950702 7:104581748-104581770 ACATGCCAAAATAATTCAATGGG - Intronic
1030015414 7:105215063-105215085 GATTGCCAAGACAATTCAATTGG + Intronic
1030414536 7:109225695-109225717 AGATGCCAAGAAAATTCAATGGG - Intergenic
1030506444 7:110430074-110430096 CAGTTCCAAGGTAATTCAATGGG + Intergenic
1031091082 7:117355447-117355469 GGGTGCCAAGACAATTCAATGGG + Intergenic
1031438343 7:121761036-121761058 GGGTGCCAAGACCATTCAATGGG + Intergenic
1031462977 7:122074741-122074763 TAGTGCTAAGACAATTCAATGGG - Intergenic
1031559230 7:123217564-123217586 GGGGGCCAAGACAATTCAATGGG + Intergenic
1031754241 7:125618214-125618236 CAGTGGCAAGATGATTCTTTGGG + Intergenic
1031862800 7:127001140-127001162 AAGTGCCAAGATAATTTAATAGG + Intronic
1032276250 7:130458300-130458322 GGGTGCCAAGACAATTCACTAGG - Intergenic
1032363870 7:131281303-131281325 GAGTGCCAAGACAATTCGATAGG - Intronic
1033178881 7:139154602-139154624 GAGTGCCAAGACCATTCAAAGGG - Intronic
1033296635 7:140144233-140144255 GAGTGCCAAGATCATTCAAAGGG + Intronic
1034354348 7:150440676-150440698 GAGTGCCAAAACCATTCAATGGG - Intergenic
1035052536 7:156008182-156008204 GGGTCCCAAGAAAATTCAATGGG - Intergenic
1035150360 7:156865804-156865826 GAGTATCAAGATAATTCAGTTGG + Intronic
1035549905 8:514331-514353 GAGTGCCAAGACAATTCAATGGG + Intronic
1036554453 8:9846373-9846395 GAGTGCCAAGACAATTCAGTGGG + Intergenic
1036734682 8:11301379-11301401 AAGTACCAATACAATTCAATTGG + Intronic
1038064038 8:23943151-23943173 GAATGCTGAGATAATTCAATGGG - Intergenic
1039163730 8:34652272-34652294 AGGTGCCAAGATTATTGAATGGG + Intergenic
1040036752 8:42877541-42877563 GGGTGCCAAGACCATTCAATAGG + Intronic
1040643864 8:49375443-49375465 GGATGCCAAGATAATTCAATGGG + Intergenic
1040938633 8:52809293-52809315 GGGTGCCAAGACCATTCAATGGG - Intergenic
1040958874 8:53009726-53009748 AGGCGCCAAGACAATTCAATGGG - Intergenic
1041033941 8:53767691-53767713 GGATGCCAAGATAATTCAATAGG + Intronic
1041357833 8:57020553-57020575 AATTGCCAAAATAATTTAATGGG + Intergenic
1041500837 8:58536468-58536490 CAGTTCCTAGATAGTTCATTTGG + Intergenic
1041598107 8:59681439-59681461 CAATTCTGAGATAATTCAATTGG - Intergenic
1041836419 8:62221622-62221644 CAGTGCCAAGAATACACAATAGG + Intergenic
1041940222 8:63379179-63379201 GATTGCCAAGATCATTTAATGGG - Intergenic
1041954988 8:63548442-63548464 CAGGGCAAAGATATTTCAAATGG + Intergenic
1042376631 8:68059744-68059766 CAGTGCCAAGCTTATTCAGGTGG + Intronic
1042805707 8:72768827-72768849 GGGTGCCAAGACAATTTAATGGG - Intronic
1043433300 8:80214984-80215006 CAGTGCAAAGACTATACAATGGG + Intronic
1043751288 8:83938832-83938854 GGATGCCAAGATAATTCAATGGG - Intergenic
1043916741 8:85931253-85931275 GAGTGCCAAGACCATTCAATGGG + Intergenic
1043953378 8:86334947-86334969 AAGTTCCAAAGTAATTCAATGGG + Intergenic
1044531129 8:93308928-93308950 CAGGGCCAAGATGATTGAAATGG + Intergenic
1044594535 8:93945644-93945666 GGGTGCCAAGACAATTCAGTTGG + Intergenic
1044901773 8:96953861-96953883 AACTGACAAGATAATTCAGTGGG - Intronic
1045088802 8:98716896-98716918 GAGTGTCAAGAACATTCAATAGG + Intronic
1045102110 8:98855389-98855411 AAGAACCAAGATCATTCAATGGG + Intronic
1045554694 8:103204680-103204702 TGGTGCCAAGACACTTCAATGGG - Intronic
1045715752 8:105042666-105042688 AAGTGACAAGTTATTTCAATAGG + Intronic
1046000545 8:108415973-108415995 AAGTGCCAAGAAAATTGAATGGG + Intronic
1046120048 8:109834543-109834565 ACATGCCAAGGTAATTCAATAGG + Intergenic
1046996397 8:120528927-120528949 TGGTGCCAAGAAAAGTCAATGGG - Intronic
1047562396 8:126001800-126001822 AAGTGCCAAAGGAATTCAATGGG + Intergenic
1048490602 8:134889165-134889187 ATGTGCCATGATAATTCAATGGG - Intergenic
1048547446 8:135400867-135400889 GAACACCAAGATAATTCAATAGG - Intergenic
1049049015 8:140177405-140177427 ATGTGCCAAGGTAATTCAAAGGG - Intronic
1049703897 8:144029241-144029263 GTGTGCAAAGACAATTCAATGGG - Intronic
1049926448 9:413135-413157 GAGTGCCAAAACAATTCAATGGG + Intronic
1050426881 9:5520315-5520337 GGGTGCCAAGACAGTTCAATAGG + Intronic
1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG + Intronic
1051280320 9:15436431-15436453 AAGGGCCAAGATCATTCACTAGG - Intronic
1051803733 9:20966780-20966802 GGGTGCCAAGATCCTTCAATGGG - Intronic
1051807641 9:21013294-21013316 CAATGCCAAGACCATTCAATGGG - Intronic
1051991864 9:23161608-23161630 CAGTGGCAAGATGAATCTATGGG - Intergenic
1052004788 9:23333659-23333681 GGGTGCCAAGACAATTCAATAGG + Intergenic
1052063174 9:23986034-23986056 AAGTGCCAAGAACATACAATGGG - Intergenic
1052158462 9:25225506-25225528 CAGTGACAACATGGTTCAATAGG + Intergenic
1052625112 9:30964510-30964532 CAGTTCAAATATATTTCAATGGG + Intergenic
1052897795 9:33764116-33764138 AGATGCCAAGACAATTCAATAGG + Intronic
1053317840 9:37067639-37067661 GCGTGCCAAGAACATTCAATGGG + Intergenic
1053322211 9:37109163-37109185 GGGTGCCAAGAACATTCAATAGG + Intergenic
1053398104 9:37793456-37793478 AGGTGCCAAGACAATTCAATGGG + Intronic
1053552189 9:39094608-39094630 CTTTGTCAAGATCATTCAATAGG - Intronic
1053558798 9:39167550-39167572 CAGTGCAAAGTTAATTTAATAGG - Intronic
1053822925 9:41987778-41987800 CAGTGCAAAGTTAATTTAATAGG - Intronic
1054138313 9:61451391-61451413 CAGTGCAAAGTTAATTTAATAGG + Intergenic
1054356120 9:64065243-64065265 GGGTGCCAAGATTATTCAGTGGG + Intergenic
1054607649 9:67199587-67199609 CAGTGCAAAGTTAATTTAATAGG + Intergenic
1055153426 9:73031398-73031420 GAATGCCAAGATTATTCAATGGG - Intronic
1055203984 9:73704663-73704685 AAGTACCAAGACAATTCAATGGG + Intergenic
1055254404 9:74350305-74350327 AAATGCCAGGATAGTTCAATGGG - Intergenic
1055534916 9:77230493-77230515 GCCTGCCAAGATCATTCAATGGG - Intronic
1055544249 9:77350981-77351003 CAATTCTAAGATAATTTAATTGG - Intronic
1055555952 9:77473886-77473908 AGGTGCCAAGCTAATTCAATGGG + Intronic
1056033503 9:82579418-82579440 GAGTGCCAACACCATTCAATGGG - Intergenic
1056125160 9:83529201-83529223 GAGTGACAAGACAATTCAACAGG + Intronic
1056378792 9:86038661-86038683 AGGTGCCAAGACAATTCAGTGGG + Intronic
1056394686 9:86170912-86170934 GAGTACCAAGACAATTCAATCGG - Intergenic
1056394790 9:86172049-86172071 GAGTACCAAGACAATTCGATGGG - Intergenic
1056510814 9:87303590-87303612 GAGTGCCAAGACAATTTAATGGG + Intergenic
1056564757 9:87761306-87761328 AAGTGCCAAGAACATACAATAGG - Intergenic
1056871442 9:90284727-90284749 TCGTGCCAAGAAAATTCAATGGG + Intergenic
1057121119 9:92574939-92574961 ATGTGCCAAGACCATTCAATGGG + Intronic
1057187950 9:93068434-93068456 GGGTACCAAGACAATTCAATGGG - Intronic
1057269503 9:93642045-93642067 GAGTGCCAAAACAGTTCAATGGG - Intronic
1057446599 9:95120276-95120298 AGATGCCAAGACAATTCAATGGG - Intronic
1057456136 9:95213530-95213552 GGGTGCCAAGATCATTCAATGGG + Intronic
1057703439 9:97380632-97380654 AGGTGCCAAGACAATTTAATGGG - Intergenic
1057756505 9:97842398-97842420 CAGTGCCAAGGTAATTCAATGGG + Intergenic
1057926583 9:99157207-99157229 ATGTGCAAAGATAATTCAACAGG + Intergenic
1058067979 9:100570542-100570564 GGGTGCTAAGATAACTCAATGGG - Intronic
1058304211 9:103416754-103416776 GAGTGCCAAGACAATTCAATGGG - Intergenic
1059163157 9:112054262-112054284 GAGTGCCAAGACCATTCAATAGG + Intronic
1059370902 9:113834042-113834064 GAGAGCCAAGAAAATTCAATGGG + Intergenic
1059654465 9:116345017-116345039 CAGTGAGAACATAATTGAATGGG + Intronic
1060447118 9:123700023-123700045 AGGTGCCAAGGTAATTCAAAGGG - Intronic
1060546179 9:124461545-124461567 AGGTGACAAGAAAATTCAATGGG - Intronic
1061011519 9:127958061-127958083 CAGTGCCAAAATAATTCAGTGGG + Intronic
1061018710 9:127999492-127999514 TGGTACCAGGATAATTCAATGGG - Intergenic
1061220785 9:129250094-129250116 GGGTGCCAAGACCATTCAATGGG + Intergenic
1062140346 9:134953759-134953781 GGGTGCCAAGACCATTCAATAGG - Intergenic
1062335605 9:136064931-136064953 GGGTGCCAAGACCATTCAATGGG + Intronic
1062675004 9:137737384-137737406 GAGTGCCAAGACCATTCAACGGG + Intronic
1203744251 Un_GL000218v1:32180-32202 GAGTGCCAAGATTATTCAGTGGG + Intergenic
1203565858 Un_KI270744v1:87334-87356 GAGTGCCAAGATTATTCAGTGGG - Intergenic
1187119422 X:16389582-16389604 GTGTGCCAAGACAATTAAATGGG + Intergenic
1187129247 X:16485716-16485738 GGGTGCCAAGACAAATCAATGGG + Intergenic
1187228813 X:17401114-17401136 GGGTGCCAAGACAATTCAATGGG + Intronic
1187362176 X:18638914-18638936 GGGTGCCAAGATCATTCAATGGG + Intronic
1187421896 X:19142414-19142436 GAGTGCCAAAACAATTCAATAGG + Intergenic
1187606292 X:20886774-20886796 CAGGGCTAAGAGAAGTCAATTGG + Intergenic
1187671453 X:21669906-21669928 GCGTGCCAAGACCATTCAATGGG - Intergenic
1187910587 X:24107600-24107622 GGGTGCCAAGACAATTCCATGGG - Intergenic
1188180868 X:27053976-27053998 TAGTACCAAGATAATTCAACAGG - Intergenic
1188402441 X:29762836-29762858 CAGTGCCAGCACAATTTAATTGG + Intronic
1188424972 X:30036131-30036153 CAGTGCCAAGAACATACACTGGG - Intergenic
1188429249 X:30086826-30086848 CAATGCCAAAAAAATTAAATGGG + Intergenic
1188495277 X:30776724-30776746 GGTTGTCAAGATAATTCAATGGG - Intergenic
1188794939 X:34451776-34451798 ATATGCCAAGATAATTCAATGGG + Intergenic
1189647664 X:43151475-43151497 AAGTGCCAAGATAATGGAAAAGG + Intergenic
1189862264 X:45285634-45285656 GGGTGCCAAGACAATTCAATTGG - Intergenic
1190145416 X:47887089-47887111 AAGTGCCAATGTGATTCAATGGG - Intronic
1190159890 X:48024116-48024138 GGGTGCCAAGATCATTTAATGGG - Intronic
1190583291 X:51909741-51909763 GGGTGCCAAGATTACTCAATGGG - Intergenic
1190631422 X:52390698-52390720 GGGTGCCAAGATAATTCAGTGGG + Intergenic
1190635491 X:52428882-52428904 AGGTGCCAAGATAATTTAGTGGG - Intergenic
1190640505 X:52479435-52479457 AAGTGCCAAGAGAATTCAGTGGG - Intergenic
1190647167 X:52533430-52533452 AAGTGCCAAGAGAATTCAGTGGG + Intergenic
1190649299 X:52553610-52553632 AAGTGCCAAGATAATTCAGTGGG + Intergenic
1190824740 X:54007138-54007160 AGGTGTCAAGACAATTCAATGGG + Intronic
1190835783 X:54099732-54099754 GGGTGCCAAGATAATTCAATGGG - Intronic
1190841278 X:54146859-54146881 AAGTGCAAAGGTAATTCAATGGG + Intronic
1191637754 X:63395910-63395932 GGATGCCAAGATTATTCAATTGG - Intergenic
1192002298 X:67166115-67166137 GGGTGCTAAGACAATTCAATGGG + Intergenic
1192241547 X:69333812-69333834 GAGTGTCAAGACAATTCAGTGGG - Intergenic
1192281309 X:69689015-69689037 GAGTGCCGAGAGAATTCAATAGG - Intronic
1192345971 X:70306163-70306185 GTATGCCAAGACAATTCAATGGG - Intronic
1192413487 X:70955801-70955823 GGGTGCCAAGACAATGCAATAGG + Intergenic
1192622370 X:72691173-72691195 AGGTGCCAAGATAATTCAATGGG - Intronic
1193057658 X:77171270-77171292 AAGTGCCAAGAACATTCATTGGG + Intergenic
1193249722 X:79276197-79276219 CACAGCCAAGATAATGAAATGGG + Intergenic
1193378255 X:80787499-80787521 ATGTGCCACGATAATCCAATGGG + Intronic
1193463742 X:81821566-81821588 TGGTGCCAAGACAATTCGATGGG + Intergenic
1193503664 X:82311320-82311342 GAGTGTCAAGAAAATTCAATGGG - Intergenic
1193545361 X:82820392-82820414 CAATGCCAAGTTCATTCAATGGG - Intergenic
1193903162 X:87208798-87208820 GAGTTCCAAGATCATTCAGTAGG + Intergenic
1194110727 X:89830766-89830788 AAGTGCCAAGAACATACAATAGG + Intergenic
1194350018 X:92815350-92815372 GGATGCCAAGATCATTCAATAGG + Intergenic
1194375722 X:93131310-93131332 GGGTGCCAAGACAATTAAATGGG - Intergenic
1194921331 X:99769414-99769436 CAGTGCCAAGGAAACACAATAGG + Intergenic
1195331347 X:103804262-103804284 GACTGCCAGGATAATTTAATGGG - Intergenic
1195571959 X:106407043-106407065 CAGTTCCAAGATGACTGAATAGG + Intergenic
1195580742 X:106498577-106498599 GAGTGCCAGGACAATTCAATGGG - Intergenic
1195745133 X:108109741-108109763 GGGTGCCAAGACCATTCAATGGG - Intronic
1195972230 X:110485692-110485714 AAGTGCCAGGATCATTCAATGGG - Intergenic
1196043904 X:111235799-111235821 GAGTGCCAACACTATTCAATGGG + Intergenic
1196067436 X:111480125-111480147 GAGTGCCAAGACAATTCAATGGG - Intergenic
1196121208 X:112052877-112052899 GAGTGCCAAGACCATTCAATGGG - Intronic
1196281359 X:113826866-113826888 AGGTGCCAAGAAAATTCAATGGG + Intergenic
1196822989 X:119718237-119718259 AAGTATCAAGACAATTCAATGGG + Intergenic
1197009421 X:121543001-121543023 GTTTGCCAAGAAAATTCAATGGG - Intergenic
1197018787 X:121660467-121660489 TGGTGCCAAGAGAATACAATGGG + Intergenic
1197038877 X:121910237-121910259 GGGTTCCAAGTTAATTCAATGGG - Intergenic
1197091229 X:122539928-122539950 AACTGCCAATATAATTCACTGGG + Intergenic
1197179997 X:123524271-123524293 GAGTACCAAGATCATTCAATGGG - Intergenic
1197403634 X:126025068-126025090 GAGTGCTAAGACAATTCAGTGGG - Intergenic
1197626064 X:128803855-128803877 AAGGGCCAAGAAAATTCAAGTGG - Intergenic
1197875788 X:131104601-131104623 GAGTGCCAAGACAAGGCAATGGG - Intergenic
1198134541 X:133735334-133735356 TAGTGCCAAGACAATTCATGGGG + Intronic
1198180511 X:134203491-134203513 GAGTGCCAAGACAATTCAAAAGG + Intergenic
1198315158 X:135458086-135458108 GAGTGCCAAGATAATTCAATAGG - Intergenic
1199016595 X:142823220-142823242 GAGTGCCAAGAGCATTCAATAGG - Intergenic
1199141282 X:144316538-144316560 AAATGCCAAGATAATTTAATGGG + Intergenic
1199337404 X:146635222-146635244 CCGTGCCGAGACAACTCAATAGG + Intergenic
1199508100 X:148589057-148589079 CAGTGACAAGACAATCAAATTGG + Intronic
1199722879 X:150555280-150555302 AGGTGCCAAGACAATTCAATGGG + Intergenic
1199723634 X:150561299-150561321 AGGTGCCAAGACCATTCAATGGG - Intergenic
1199923548 X:152436607-152436629 GGGTGCCAAGGTAATTCAATGGG + Intronic
1200302343 X:154989936-154989958 GAGTGCCAAAACCATTCAATAGG - Intronic
1200313961 X:155111486-155111508 CTGTGCCATGATAATTCAACAGG + Intronic
1201157576 Y:11147161-11147183 GGGTGCCAAGATTATTCAGTGGG + Intergenic