ID: 1088866586

View in Genome Browser
Species Human (GRCh38)
Location 11:113853500-113853522
Sequence AATATCTACGAGAGTATAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088866586_1088866588 8 Left 1088866586 11:113853500-113853522 CCTCCTATACTCTCGTAGATATT 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1088866588 11:113853531-113853553 AACCCTAACCATCTTATCACTGG 0: 1
1: 0
2: 2
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088866586 Original CRISPR AATATCTACGAGAGTATAGG AGG (reversed) Intronic
902677982 1:18022235-18022257 ATTATTTACGAGAGCAGAGGTGG - Intergenic
903361477 1:22779961-22779983 AATAGCTATGAGAGAGTAGGGGG - Intronic
904718651 1:32489118-32489140 AAAATTTGCGAGAGTATAAGGGG - Exonic
906334878 1:44920387-44920409 AATAACTAAGAGAGTATAATTGG - Intronic
916258505 1:162815721-162815743 AATATCTTCCAGAATATAGAAGG - Intergenic
921098292 1:211905999-211906021 AATATCTACTAGTGTATATATGG - Intergenic
1062953217 10:1521339-1521361 AATGTCTAAGACAGTACAGGTGG - Intronic
1065257040 10:23880587-23880609 AATAACTAAAAGAGTATAGCTGG + Intronic
1065431090 10:25656685-25656707 AATATCTAAAAGAGTATAATTGG - Intergenic
1068362665 10:55998968-55998990 AATAACTACAAGAGTATAATCGG + Intergenic
1081006596 11:37751994-37752016 AATAACTAAGAGAGTATAATTGG + Intergenic
1082132308 11:48505874-48505896 AATAACTAAAAGAGTATAAGTGG + Intergenic
1082565773 11:54676494-54676516 AATAACTAAAAGAGTATAAGTGG + Intergenic
1085106972 11:73853227-73853249 AATAACTAAAAGAGTATAGTTGG + Intronic
1086271667 11:85074697-85074719 AATGTCTTCAAGAATATAGGAGG + Intronic
1087345618 11:96967100-96967122 AATAACTAAAAGAGTATAGTTGG + Intergenic
1088672799 11:112159831-112159853 AATATCTAGGACAGAATGGGAGG + Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1088924893 11:114291804-114291826 AATGGCTAAGAGAGTAAAGGTGG - Intronic
1092044149 12:5415360-5415382 AATATCAACGTGAGTTTTGGTGG + Intergenic
1101461032 12:104893985-104894007 AATAACTACAAGAGTATAATTGG + Intronic
1101480808 12:105095186-105095208 AATAACTAAGAGAGTATAGTTGG - Intergenic
1108252383 13:48580099-48580121 AATAACTAAAAGAGTATAGTTGG + Intergenic
1111169775 13:84510789-84510811 AATGTCTATGAGATTCTAGGAGG + Intergenic
1112465894 13:99644516-99644538 AATAACTACAAGAGTATAACTGG - Intronic
1116193356 14:41688297-41688319 AACAACTAAGAGAGTATAGTTGG + Intronic
1116393972 14:44426124-44426146 AATATCTAAAAGAGTATAATTGG + Intergenic
1120822267 14:88922921-88922943 AATAACTAAGAGAGTATAACTGG - Intergenic
1121177606 14:91902815-91902837 AATATTTAAGAGAGTCTAAGAGG + Intronic
1125115887 15:36091218-36091240 TATATCTCCGGGAGTAGAGGGGG + Intergenic
1126857640 15:52854530-52854552 ACTATCTACGAGAGTGGGGGAGG - Intergenic
1127033082 15:54885594-54885616 AATAACTAAAAGAGTATAAGTGG - Intergenic
1127209992 15:56764303-56764325 AACATCTATGAGTGTATAGCAGG - Intronic
1128623117 15:69168992-69169014 AATGACTAAGAGAGTACAGGAGG - Intronic
1133457756 16:5957820-5957842 AATAACTAAAAGAGTATAAGTGG - Intergenic
1133490015 16:6258744-6258766 AATAACTAAGAGAGTTTAGTTGG + Intronic
1137439759 16:48488321-48488343 AATATTTAAGAGAGAATGGGAGG - Intergenic
1139084150 16:63563474-63563496 AATAACTATGAGTGTATAGAAGG - Intergenic
1149006950 17:51815930-51815952 AATAACTACAAGAGTGTAGTTGG - Intronic
1154162630 18:11991305-11991327 AATAGCCACGAGACTAAAGGAGG + Intronic
1164855953 19:31521674-31521696 AATAACTAAAAGAGTATAAGTGG - Intergenic
927350725 2:22110481-22110503 AATAATTACCAGAGTAAAGGAGG + Intergenic
932920524 2:75909236-75909258 AATATCTACAAGAGTATAACTGG - Intergenic
934339637 2:92244131-92244153 AATATCTGCAAGAGTATATTTGG + Intergenic
934348362 2:92382667-92382689 AATATCTGCAAGAGTATATTTGG + Intergenic
934372390 2:92765145-92765167 AATATCTGCAAGAGGATAGTTGG + Intergenic
934414824 2:93448984-93449006 AATATCTGCAAGAGTATATTTGG + Intergenic
934419804 2:93528943-93528965 AATATCTGCAAGAGTATATTTGG + Intergenic
934421263 2:93552396-93552418 AATATCTGCAAGAGTATATTTGG + Intergenic
934433786 2:93753793-93753815 AATATCTGCAAGAGTATATTTGG + Intergenic
934443836 2:93916139-93916161 AATATCTGCAAGAGTATATTTGG + Intergenic
941911987 2:170772318-170772340 AATATTAACAATAGTATAGGAGG + Intergenic
1179279476 21:39922265-39922287 AAAATCTACTTGAGTATATGAGG + Intronic
1182799446 22:33019436-33019458 AATATCTATGAGAGTTGGGGTGG + Intronic
1184305543 22:43598629-43598651 AATATCTAAAAGAGTATAATTGG + Intronic
1202721673 2_KI270715v1_random:90515-90537 AATATCTGCAAGAGTATATTTGG + Intergenic
1202721794 2_KI270715v1_random:92555-92577 AATATCTGCAAGAGTATATTTGG + Intergenic
953203316 3:40797555-40797577 AATATCTATGAGAGAAAATGTGG - Intergenic
953380313 3:42466087-42466109 AATAACTAAAAGAGTATAAGTGG + Intergenic
957332998 3:78790471-78790493 AATAACTAAGAGAGTATAACTGG - Intronic
964412289 3:156410468-156410490 AATATCTACCAGAATGTTGGAGG - Intronic
964521101 3:157568419-157568441 AATAACTAAAAGAGTATAAGTGG - Intronic
967618490 3:191603135-191603157 AATATCTATAGGAGTAAAGGAGG + Intergenic
974632740 4:64515315-64515337 CTTATCTAAGAGAGTAAAGGTGG - Intergenic
977231964 4:94462205-94462227 AAGATACACGAGCGTATAGGGGG + Intronic
977522268 4:98099881-98099903 AATAACTACAAGAGTATAATTGG + Intronic
978148088 4:105400791-105400813 AATATCTACCTCAGTCTAGGAGG + Intronic
978162566 4:105566567-105566589 AATATCTAAGAGAGTATAACTGG - Intronic
978584342 4:110261606-110261628 AATAACTACAAGAGTATAATTGG - Intergenic
978978676 4:114914308-114914330 AATAGCTAAAAGAGTATAGTTGG + Intronic
979129268 4:117020099-117020121 AATAACTAAAAGAGTATAAGTGG + Intergenic
980502622 4:133675803-133675825 AATGACTATGAGAGTATTGGGGG + Intergenic
984119928 4:175729579-175729601 AATAACTAAAAGAGTATAAGTGG + Intronic
984289780 4:177781123-177781145 AATAACTAAAAGAGTATAAGTGG + Intronic
985882747 5:2652763-2652785 AATGTCAAGGAGAGCATAGGGGG - Intergenic
986287524 5:6370840-6370862 AATTTCTGCTAGAGTAGAGGAGG - Intergenic
987604783 5:20119106-20119128 AAAATCTACAAAAGTAGAGGTGG - Intronic
989658862 5:43776568-43776590 AATAACTAAGACAGTATAAGCGG - Intergenic
990645090 5:57834848-57834870 GATTTCTACGACAGTAGAGGTGG + Intergenic
995266409 5:110166801-110166823 AATATCTAAGACATTAGAGGGGG - Intergenic
996686426 5:126286498-126286520 AATATCTACCAGAAAATAGAAGG + Intergenic
999918976 5:156297157-156297179 AATAACTAAGAGAGTATCAGTGG - Intronic
1011033719 6:82951088-82951110 AATAACTAAAAGAGTATAAGTGG + Intronic
1011061286 6:83272011-83272033 AATAACTAAGAGAGTATAATTGG - Intronic
1011124900 6:83996463-83996485 AATATCTAGGAGAGTAATGGTGG - Intergenic
1013202541 6:107913775-107913797 AAAATATATGAGAGTATAAGGGG - Intronic
1013591761 6:111624661-111624683 AATATCCATCAGAGGATAGGTGG + Intergenic
1014365831 6:120540549-120540571 AGTATGTATGAGAGTAGAGGTGG + Intergenic
1015511708 6:134044161-134044183 AATATCTATGATAGCAAAGGGGG - Intronic
1017523058 6:155219082-155219104 ACTAACTTCGAGAATATAGGTGG - Intronic
1024454491 7:49587843-49587865 AATAACTACAAGAGTATAATTGG + Intergenic
1025061866 7:55816334-55816356 AATAACTAAAAGAGTATAGTTGG + Intronic
1025603270 7:63019253-63019275 AATAACTAAAAGAGTATAAGTGG - Intergenic
1031251704 7:119391039-119391061 AATTTCTACATGAGTATTGGAGG + Intergenic
1039781377 8:40789543-40789565 AATAACTAGGAGAGTATAATTGG + Intronic
1039933343 8:42015560-42015582 AATTTATACGACTGTATAGGAGG - Intronic
1040004973 8:42612400-42612422 AATAACTAAGAGAGTATAATTGG - Intergenic
1040958126 8:53001290-53001312 AATTGCTAAGAGAGTATAGTTGG - Intergenic
1042523680 8:69742625-69742647 CATATCGATGACAGTATAGGCGG + Intronic
1045591160 8:103599898-103599920 AATAACTACAAGAGTATAATTGG - Intronic
1047658447 8:127004916-127004938 AATATCTACGTTAGGATAGAGGG + Intergenic
1047726263 8:127686608-127686630 TATATGTATGAGGGTATAGGAGG + Intergenic
1052595489 9:30552439-30552461 AATAGCTTTGAGAGTACAGGGGG + Intergenic
1055897292 9:81192950-81192972 AATATCTACAGTAGTAAAGGTGG + Intergenic
1056912098 9:90711022-90711044 AATATTTGCCAGAGGATAGGGGG + Intergenic
1061827206 9:133266259-133266281 AATAACTAAAAGAGTATAGTTGG + Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1188058304 X:25567532-25567554 AATATCTAGGATATTTTAGGAGG - Intergenic
1188071328 X:25721485-25721507 AATAACTACAAGAGTATATTTGG - Intergenic
1188344582 X:29047900-29047922 ATTATGTAAGAGATTATAGGGGG - Intronic
1189088836 X:38055968-38055990 AATAACTAAAAGAGTATAGGTGG - Intronic
1189577559 X:42370834-42370856 AATAACTAAAAGAGTATAGTTGG - Intergenic
1190373840 X:49769270-49769292 AATATCTAAAAGAGTATAACTGG - Intergenic
1191766024 X:64699044-64699066 AATAACTAAAAGAGTATAGTTGG - Intergenic
1191990918 X:67036038-67036060 AATAACTAAGAGAGTATAATTGG - Intergenic
1192886553 X:75341398-75341420 AATATCTAAAAGAGTATAATTGG - Intergenic
1193245686 X:79225995-79226017 AATAACTAAGAGAGTATAACTGG - Intergenic
1194394883 X:93371057-93371079 AATAACAACGTGTGTATAGGGGG - Intergenic
1195781915 X:108476420-108476442 AATAACTAAGAGAGTATAACTGG - Intronic
1195882909 X:109611316-109611338 AATGTTTAGGAGAGTAGAGGAGG + Intergenic
1197325088 X:125082936-125082958 AATAACTACAAGAGTATAATTGG - Intergenic
1197357470 X:125453378-125453400 AATAACTACAAGAGTATAATTGG + Intergenic
1197672769 X:129296886-129296908 AATATCTTCCAGACAATAGGAGG + Intergenic
1199194464 X:145011020-145011042 AATATCTATAAGAGTATAACTGG + Intergenic