ID: 1088866588

View in Genome Browser
Species Human (GRCh38)
Location 11:113853531-113853553
Sequence AACCCTAACCATCTTATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088866587_1088866588 5 Left 1088866587 11:113853503-113853525 CCTATACTCTCGTAGATATTCTG 0: 1
1: 0
2: 1
3: 3
4: 71
Right 1088866588 11:113853531-113853553 AACCCTAACCATCTTATCACTGG 0: 1
1: 0
2: 2
3: 8
4: 68
1088866586_1088866588 8 Left 1088866586 11:113853500-113853522 CCTCCTATACTCTCGTAGATATT 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1088866588 11:113853531-113853553 AACCCTAACCATCTTATCACTGG 0: 1
1: 0
2: 2
3: 8
4: 68
1088866585_1088866588 28 Left 1088866585 11:113853480-113853502 CCTTTCTTATTTTCTCTAAACCT 0: 1
1: 1
2: 5
3: 82
4: 681
Right 1088866588 11:113853531-113853553 AACCCTAACCATCTTATCACTGG 0: 1
1: 0
2: 2
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088866588 Original CRISPR AACCCTAACCATCTTATCAC TGG Intronic
915360449 1:155283299-155283321 AATCCTAACAGTCTTATCACAGG - Intronic
916405248 1:164491807-164491829 AAACCTACCCATCAAATCACAGG + Intergenic
918575982 1:186060876-186060898 TTTCCTAACCATCTGATCACAGG + Intronic
919116197 1:193283539-193283561 AAGCCTAACTATCTTATCTGCGG + Intergenic
920702373 1:208227496-208227518 CAGCCAAACCTTCTTATCACTGG + Intronic
922574731 1:226654246-226654268 AACCCCAACCATCTTTGCATTGG + Intronic
1064893080 10:20201919-20201941 AACTAAAACCATCTTAGCACTGG + Intronic
1069100352 10:64312529-64312551 AACCTCAACCCTCTTATCGCTGG - Intergenic
1070671816 10:78382800-78382822 AACCTTAACCATGTTATTCCTGG - Intergenic
1070922463 10:80196713-80196735 AACCCTGACCATATTTTCCCAGG + Intronic
1072483881 10:95835508-95835530 ATCTCTAACCTTCTTTTCACAGG + Intronic
1076509810 10:131005114-131005136 CACCCTAACCATCCAATCAGAGG - Intergenic
1076604524 10:131680944-131680966 AACCCTGAGCATCCTATCAGGGG + Intergenic
1084057740 11:66647637-66647659 AACCCTACCCATCAGATCAAAGG - Intronic
1084266661 11:68008626-68008648 CACCCTAACTATCTAATCACGGG + Intronic
1086224872 11:84495704-84495726 AACACTAACCATATGAACACTGG + Intronic
1088866588 11:113853531-113853553 AACCCTAACCATCTTATCACTGG + Intronic
1096134225 12:49186401-49186423 CACCCTGAGCAACTTATCACAGG - Exonic
1102128114 12:110502040-110502062 AGCCCTCACCATCCTGTCACCGG + Exonic
1103428929 12:120864570-120864592 AAGCCCAAAAATCTTATCACTGG + Intronic
1110584369 13:77171113-77171135 TACCCTAACCATCTCCTCAGAGG - Intronic
1116983962 14:51200254-51200276 AACCCCAGCAATCTTATTACTGG - Intergenic
1118340284 14:64890089-64890111 AACCCTAACCATTTTATGACAGG + Intergenic
1119086241 14:71741837-71741859 AACCTAACCCAGCTTATCACCGG - Intergenic
1119549297 14:75496770-75496792 AACCCTAACCCTCTTCTCCAGGG + Intergenic
1124630111 15:31331356-31331378 AACCCCACCCAAATTATCACAGG - Intronic
1126564372 15:50079645-50079667 AACCCTAAGGATATTATCTCAGG + Intronic
1128548115 15:68580645-68580667 AACCCTAAGCATCTTACCCCAGG - Intronic
1138117663 16:54373287-54373309 AACCATAGCCCTTTTATCACTGG + Intergenic
1141221984 16:82079507-82079529 AACCCTAATCATCTTTTTAAAGG + Intronic
1144114789 17:12077480-12077502 AACCCTAGCCTGCTTATCTCCGG - Intronic
1144470730 17:15538713-15538735 AACCCTATCCATGTTATGCCAGG + Intronic
1148609043 17:48951768-48951790 AACCCTTACCAGGATATCACTGG - Intergenic
1148839739 17:50487454-50487476 AACACTTACCATATTACCACAGG - Intergenic
1151005449 17:70431047-70431069 AAATCAAACCATGTTATCACTGG - Intergenic
1155646360 18:28082910-28082932 AACCCTAACCCTGTTGTCACAGG - Intronic
1158522254 18:58181336-58181358 AATCCTAAACATTTTATCTCTGG - Intronic
1161908949 19:7178301-7178323 AGCCCCAACCCTCTGATCACAGG - Intronic
930329245 2:49961879-49961901 CACCCTAATCATTTTATCAATGG + Intronic
933756598 2:85644214-85644236 AAACAAAACCATGTTATCACTGG - Intronic
935558762 2:104539322-104539344 AAACCAACCCATCTGATCACTGG - Intergenic
938382454 2:130844242-130844264 AAACCTCACCACCTTATAACTGG - Intronic
938623235 2:133079517-133079539 AATCCTAAACATCTTTTCATGGG + Intronic
943224666 2:185155499-185155521 AATCCTAAGCAAATTATCACAGG + Intergenic
948104005 2:235398291-235398313 AGCCCAAACCCTCTTAACACAGG - Intergenic
1168810524 20:701678-701700 AGCCCCAACCAGCTTGTCACTGG - Intergenic
1169146025 20:3252919-3252941 AGCCCTATCCATCTTTTCACAGG + Intronic
1170017287 20:11796083-11796105 AACACTAACCATCTTTTCACTGG + Intergenic
1174170527 20:48615409-48615431 CAGACTAACCATCTTATCATTGG + Intergenic
1177301591 21:19252452-19252474 AAGCATAATCATCTTATCAATGG + Intergenic
1185092714 22:48785000-48785022 AACCCTAATCACCTCCTCACAGG - Intronic
953238904 3:41130935-41130957 GTCCCTAACCATCTCATCCCTGG + Intergenic
955020079 3:55111428-55111450 ATTCCTAGTCATCTTATCACTGG - Intergenic
955490060 3:59472907-59472929 AAACCTAACCATCTTAAGTCAGG + Intergenic
962025560 3:131543766-131543788 AACCCTGACCCTCTTATAGCAGG - Intronic
962429539 3:135306655-135306677 AACCCAAACCAACATGTCACAGG + Intergenic
966465498 3:180227319-180227341 AACCAAAACCAATTTATCACAGG + Intergenic
978990331 4:115073408-115073430 CAGCCTAAGCATCTTATCAGTGG + Intronic
979210897 4:118100652-118100674 AACATGAACCCTCTTATCACTGG - Intronic
980708606 4:136534108-136534130 AAACCTAAGCATATTAACACAGG + Intergenic
983731152 4:170995160-170995182 AACACTCACTATCGTATCACAGG - Intergenic
986371746 5:7087193-7087215 AACCATGACCAGATTATCACAGG - Intergenic
989071933 5:37519929-37519951 AATCTTAACCATTTAATCACTGG - Intronic
997935805 5:138109747-138109769 ACTCCTAACCATCTGATGACTGG - Intergenic
1001559397 5:172659414-172659436 AACCTCAGCCAGCTTATCACTGG + Intronic
1007943898 6:45808047-45808069 CAAACTAACCATCTTATTACTGG - Intergenic
1015966948 6:138703885-138703907 AACCCTAGTTCTCTTATCACTGG + Intergenic
1017695322 6:157008917-157008939 AAGCCCAAACATCTTAACACTGG - Intronic
1029847381 7:103426749-103426771 ATCAATAACCATCTTATCAGAGG + Intronic
1037218239 8:16484319-16484341 GACCCTAACCCTCATATAACTGG + Intronic
1043589912 8:81818382-81818404 AACCTGAACTATCTTTTCACAGG - Intronic
1045680457 8:104654155-104654177 AACCCTAAGCATAGTATCTCAGG - Intronic
1046379611 8:113434940-113434962 AACCCTGGTCATCTTCTCACAGG + Intronic
1047680564 8:127250142-127250164 AACAGTAACCAACTTATCACTGG - Intergenic
1048207400 8:132426298-132426320 AACCCTACCCATCATGACACCGG + Intronic
1048803464 8:138216849-138216871 AATCCTAACCATCTTATAAAAGG + Intronic
1048829063 8:138458443-138458465 AACCTTGACCATCTTATTTCAGG - Intronic
1062721250 9:138045355-138045377 AACCCTTACCATCTACTCAGTGG - Intronic
1188622403 X:32242026-32242048 AACCCTAATCATCTTATCTTGGG - Intronic