ID: 1088868967

View in Genome Browser
Species Human (GRCh38)
Location 11:113875462-113875484
Sequence GCAGGACGACGCGGCCGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088868967_1088868971 -4 Left 1088868967 11:113875462-113875484 CCGCGCCGGCCGCGTCGTCCTGC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1088868971 11:113875481-113875503 CTGCTGCAGCTCCGCAGTCATGG 0: 1
1: 0
2: 0
3: 21
4: 187
1088868967_1088868977 23 Left 1088868967 11:113875462-113875484 CCGCGCCGGCCGCGTCGTCCTGC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1088868977 11:113875508-113875530 GGCGCCCAGCCGCGGGTCACCGG 0: 1
1: 0
2: 1
3: 7
4: 118
1088868967_1088868972 2 Left 1088868967 11:113875462-113875484 CCGCGCCGGCCGCGTCGTCCTGC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1088868972 11:113875487-113875509 CAGCTCCGCAGTCATGGCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 99
1088868967_1088868974 15 Left 1088868967 11:113875462-113875484 CCGCGCCGGCCGCGTCGTCCTGC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1088868974 11:113875500-113875522 ATGGCCGAGGCGCCCAGCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 103
1088868967_1088868975 16 Left 1088868967 11:113875462-113875484 CCGCGCCGGCCGCGTCGTCCTGC 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1088868975 11:113875501-113875523 TGGCCGAGGCGCCCAGCCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088868967 Original CRISPR GCAGGACGACGCGGCCGGCG CGG (reversed) Exonic