ID: 1088871599

View in Genome Browser
Species Human (GRCh38)
Location 11:113894775-113894797
Sequence GTGAACTCCCAGATATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088871599_1088871603 8 Left 1088871599 11:113894775-113894797 CCAGGAAATATCTGGGAGTTCAC No data
Right 1088871603 11:113894806-113894828 CCCCTTAGCCAACAGCTGACAGG No data
1088871599_1088871606 11 Left 1088871599 11:113894775-113894797 CCAGGAAATATCTGGGAGTTCAC No data
Right 1088871606 11:113894809-113894831 CTTAGCCAACAGCTGACAGGTGG No data
1088871599_1088871607 12 Left 1088871599 11:113894775-113894797 CCAGGAAATATCTGGGAGTTCAC No data
Right 1088871607 11:113894810-113894832 TTAGCCAACAGCTGACAGGTGGG No data
1088871599_1088871609 28 Left 1088871599 11:113894775-113894797 CCAGGAAATATCTGGGAGTTCAC No data
Right 1088871609 11:113894826-113894848 AGGTGGGAGTGAGAGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088871599 Original CRISPR GTGAACTCCCAGATATTTCC TGG (reversed) Intergenic
No off target data available for this crispr