ID: 1088871694

View in Genome Browser
Species Human (GRCh38)
Location 11:113895799-113895821
Sequence CTGGGTGAAGAGAGGGTGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088871694_1088871700 26 Left 1088871694 11:113895799-113895821 CCGTTCACCCTCTCTTCACCCAG No data
Right 1088871700 11:113895848-113895870 CCATTTGTGAAAAGTCACTGAGG No data
1088871694_1088871701 30 Left 1088871694 11:113895799-113895821 CCGTTCACCCTCTCTTCACCCAG No data
Right 1088871701 11:113895852-113895874 TTGTGAAAAGTCACTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088871694 Original CRISPR CTGGGTGAAGAGAGGGTGAA CGG (reversed) Intergenic
No off target data available for this crispr