ID: 1088872194

View in Genome Browser
Species Human (GRCh38)
Location 11:113900365-113900387
Sequence CCTTCCAAGGATGATGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088872186_1088872194 -10 Left 1088872186 11:113900352-113900374 CCCCCACACTCATCCTTCCAAGG No data
Right 1088872194 11:113900365-113900387 CCTTCCAAGGATGATGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088872194 Original CRISPR CCTTCCAAGGATGATGTCTG GGG Intergenic
No off target data available for this crispr