ID: 1088873324

View in Genome Browser
Species Human (GRCh38)
Location 11:113911618-113911640
Sequence GCAGGAAAATTGCTTGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129592
Summary {0: 1, 1: 9, 2: 1374, 3: 37644, 4: 90564}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088873324_1088873327 -1 Left 1088873324 11:113911618-113911640 CCGGGGACAAGCAATTTTCCTGC 0: 1
1: 9
2: 1374
3: 37644
4: 90564
Right 1088873327 11:113911640-113911662 CCTCAGCCTCCTGAGTAGCTAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
1088873324_1088873329 7 Left 1088873324 11:113911618-113911640 CCGGGGACAAGCAATTTTCCTGC 0: 1
1: 9
2: 1374
3: 37644
4: 90564
Right 1088873329 11:113911648-113911670 TCCTGAGTAGCTAGGATTACAGG 0: 2479
1: 61175
2: 150793
3: 234901
4: 202389
1088873324_1088873331 26 Left 1088873324 11:113911618-113911640 CCGGGGACAAGCAATTTTCCTGC 0: 1
1: 9
2: 1374
3: 37644
4: 90564
Right 1088873331 11:113911667-113911689 CAGGTGTCTGCCACCACACTCGG 0: 10
1: 450
2: 5583
3: 26729
4: 78311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088873324 Original CRISPR GCAGGAAAATTGCTTGTCCC CGG (reversed) Intronic
Too many off-targets to display for this crispr