ID: 1088878370

View in Genome Browser
Species Human (GRCh38)
Location 11:113954455-113954477
Sequence CAGGGTAAGCAGGCTTAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088878363_1088878370 11 Left 1088878363 11:113954421-113954443 CCTTAATTGTTTCTGCGGGAAAG No data
Right 1088878370 11:113954455-113954477 CAGGGTAAGCAGGCTTAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088878370 Original CRISPR CAGGGTAAGCAGGCTTAGGA CGG Intergenic
No off target data available for this crispr