ID: 1088883503

View in Genome Browser
Species Human (GRCh38)
Location 11:113989652-113989674
Sequence GCTGCGCGTGGGCTCCGTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088883498_1088883503 -2 Left 1088883498 11:113989631-113989653 CCGAGAGGTGGCCCGAGACTGGC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 136
1088883494_1088883503 19 Left 1088883494 11:113989610-113989632 CCTGGAAAAGCGGGATGAGATCC 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 136
1088883492_1088883503 28 Left 1088883492 11:113989601-113989623 CCGGCAATTCCTGGAAAAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088883503 Original CRISPR GCTGCGCGTGGGCTCCGTGC TGG Exonic
900244008 1:1629457-1629479 CCTGCACGTGGGCGCCGCGCCGG + Exonic
900473845 1:2867228-2867250 TCTGAGAGTGGGCTCTGTGCTGG + Intergenic
901759771 1:11463200-11463222 CCTGCTTGTGGGCTCCTTGCTGG + Intergenic
904009650 1:27382513-27382535 GCTGCGTGTGGGAGCAGTGCCGG - Exonic
904581731 1:31548703-31548725 GGTGGCCGTGGGCTCCCTGCAGG + Intergenic
904744473 1:32702634-32702656 GCCGCGCCGGGGCTCCGGGCTGG + Exonic
905372039 1:37487517-37487539 GCTGCTCGTGGGCTGCTTGTGGG + Intergenic
905416464 1:37807931-37807953 GCTGCGCGCCGGCGCCGTGGTGG - Exonic
907241202 1:53081990-53082012 GCTGGCTGTGGGCTCCGTGGTGG + Exonic
910757233 1:90706641-90706663 GCGGCGCGCCGGCTCCGTGCGGG - Intergenic
912948472 1:114104362-114104384 GCAGAGCGTGTGCTCTGTGCTGG - Intronic
915581064 1:156813772-156813794 CCTGCGCCTGGGCTCTGAGCGGG + Intronic
1062764290 10:49070-49092 GCGGCCCCTGGGCTCCCTGCCGG - Intronic
1063088057 10:2837177-2837199 GCTGGGCGTGGGCACTGTCCTGG - Intergenic
1070722979 10:78769499-78769521 GGTTCTCCTGGGCTCCGTGCAGG + Intergenic
1070761184 10:79025333-79025355 GCCCAGCGTGGGCTCTGTGCAGG + Intergenic
1076593310 10:131606995-131607017 GCTGCGTGTGGGCTCCCTGAAGG - Intergenic
1078180090 11:9004083-9004105 GCGGGGCGTGGACTCTGTGCCGG - Intergenic
1079630319 11:22666842-22666864 GAGGCGCTTGGGCTCCGGGCTGG - Exonic
1080204390 11:29712668-29712690 GCTGCGCGTGGTGTTCTTGCAGG + Intergenic
1081549118 11:44095954-44095976 GCCGCGCGGAGGCTCCGTGGAGG + Intronic
1083296120 11:61716555-61716577 GCTGAGGGTGGGCTCTGTGCTGG + Intronic
1083333388 11:61909450-61909472 GCTGGAAGTGGGCTCCTTGCAGG - Intronic
1083547553 11:63560258-63560280 GCTGAGCTGGGGCTCCTTGCAGG - Intronic
1083660990 11:64251661-64251683 GCAGCGCGTGGACGCCGGGCTGG - Exonic
1084204468 11:67583890-67583912 GCTGCGGGTTGGCCCCATGCTGG - Intronic
1085281398 11:75333465-75333487 GTTGGGTGTGGGCTCCGTGGTGG - Intronic
1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG + Exonic
1089294886 11:117461511-117461533 GCTGCGCGGGGGCTCTGACCAGG + Exonic
1090345084 11:126062939-126062961 GCTGCTCGCGTGCTCCGGGCCGG - Intronic
1090670661 11:128942961-128942983 GATGCCCCTGGGCTCCTTGCGGG + Intronic
1094491886 12:30965919-30965941 GCGGCCCGTGGGCTACGGGCTGG - Intronic
1094588759 12:31801478-31801500 GCTGCGCCTGGCCTAAGTGCTGG - Intergenic
1094814092 12:34166779-34166801 GCGGCCCCTGGGCTCCCTGCTGG - Intergenic
1096845697 12:54405251-54405273 GGTGGGCGTGGGCTCTATGCCGG + Exonic
1101870600 12:108562547-108562569 TCTGCGAGTCGGCTCCGAGCTGG - Intergenic
1102375542 12:112418784-112418806 GCAGCGCGGGGGCTCCGCGGAGG - Intronic
1102893885 12:116582958-116582980 GCTCTGTGTGGGCTCCATGCCGG - Intergenic
1104406331 12:128520204-128520226 GCTGAGCGAGGGCTCTGAGCTGG - Intronic
1106809974 13:33350077-33350099 GGTGGGTGTGGGCTCCGTGCCGG - Intronic
1107595646 13:41960801-41960823 GGTGCCCCTGCGCTCCGTGCCGG - Intronic
1112397445 13:99046195-99046217 GCTGAGCCTGGGCTCAGTGTTGG - Intronic
1113763706 13:112867730-112867752 GCTGCACGCGGGTTCCGTGGGGG - Intronic
1114620690 14:24094446-24094468 GGTGCGGGTGGGCCCCGGGCCGG - Intronic
1119263165 14:73250148-73250170 GCTGCCTGGGGGCTCAGTGCGGG + Intronic
1122942834 14:104990107-104990129 GGTGGGGGTGGGCTCTGTGCTGG + Intronic
1127997688 15:64163091-64163113 GTTGCTCGCGGGCTCCGGGCGGG + Exonic
1129455928 15:75676198-75676220 GCTGCCCCCGGGCTCCGTCCTGG + Exonic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1131200046 15:90388413-90388435 GCGGCGCGGGGGCTTCGGGCTGG + Intronic
1135091923 16:19524172-19524194 GCTGAGGGCGGGCTCTGTGCTGG + Intronic
1135998133 16:27268702-27268724 GATGCGCTTGGGCTCCCTGGTGG - Exonic
1136054758 16:27680173-27680195 GCTGGGCGTGTGCTGCATGCTGG - Intronic
1136666838 16:31819690-31819712 GCTGCTCCTGGGCTCCGGCCAGG + Intergenic
1142159645 16:88550431-88550453 GCTGCCCTTGGGCTCCTTTCCGG + Intergenic
1142440360 16:90094169-90094191 GCGGCCCCTGGGCTCCCTGCCGG + Intergenic
1142764304 17:2057002-2057024 GCCGAGCCTGGGCGCCGTGCTGG + Exonic
1142855019 17:2724441-2724463 GCTGGGCGCGGGCTGCGGGCCGG + Intergenic
1144812099 17:18007017-18007039 GCTGCACGATGGCTCAGTGCCGG + Exonic
1145049466 17:19648448-19648470 GCTGGGAGTGGGCGCCCTGCCGG - Intronic
1150485150 17:65538067-65538089 CATGCGCGTGGGCTGCGTGTGGG - Intronic
1151586640 17:75012750-75012772 GCCCGGCGTGGGCACCGTGCGGG - Exonic
1152128367 17:78461077-78461099 CCTGGGGGTGGGCTCCTTGCTGG - Intronic
1152577968 17:81151256-81151278 GCTGGGCCTGGGTTCTGTGCAGG - Intronic
1152957201 18:49389-49411 GCGGCCCCTGGGCTCCCTGCCGG - Intronic
1161507534 19:4652003-4652025 GCTGCGCGTGAACTCCCTGGTGG - Exonic
1161851339 19:6739562-6739584 GCAGTGCTTGGGCTCCGCGCGGG + Intronic
1162079455 19:8209581-8209603 GCTGCGAGTGGGGGCCGGGCTGG - Intronic
1163085915 19:14979692-14979714 GCTGCGGGAGGGATCCGGGCCGG + Intronic
1163162320 19:15471958-15471980 GCAGCGCGTGAAGTCCGTGCAGG + Exonic
1163292019 19:16385098-16385120 GAGGCGCGGGGGCTCCGTGGAGG + Intronic
1163369374 19:16893489-16893511 GCAGCGAGGGGCCTCCGTGCTGG + Intronic
1163602095 19:18255385-18255407 CCTGCGTGTGCGCTCCCTGCTGG + Exonic
1165342843 19:35224902-35224924 GCTGCTCGTGGTCACCGTCCTGG - Exonic
1167109057 19:47448098-47448120 CCTGCGCGTGGGCGACGCGCAGG - Exonic
925185978 2:1846674-1846696 TCTGCCCCTGGGCTCCGGGCCGG - Intronic
928904612 2:36356209-36356231 GCGGCGCGTGTGCCCCGCGCAGG + Exonic
937122639 2:119451526-119451548 GCTGCGAGTGGGCTCAGGCCTGG - Intronic
937996262 2:127697161-127697183 GCTGAGCCTGGGCTCTCTGCTGG - Intergenic
942227519 2:173830262-173830284 ACTTCGTGTGGGCTCCCTGCAGG - Intergenic
942346068 2:175004776-175004798 GCGGCGCGTGGGGTCGGGGCGGG - Intronic
942666952 2:178329854-178329876 GCTGCCCATTGGCTCAGTGCAGG + Intronic
945564996 2:211386903-211386925 TCTCCTCGTGGGCTCCGTTCTGG + Exonic
947548581 2:231029890-231029912 CTTGCTCGTGGGCTCTGTGCTGG + Intergenic
947611978 2:231530298-231530320 GCTGGGCCGGGGCTCGGTGCGGG - Intronic
948963216 2:241356261-241356283 GCTGCGCGGGGGCTGCCGGCGGG + Exonic
949035641 2:241814664-241814686 GCTGGCCGGGGGCTCCGTGCGGG + Exonic
1173894674 20:46541776-46541798 GCTGCGCGGGGACGCCGGGCGGG + Exonic
1176207202 20:63895451-63895473 GCTGCGCGGGCGCTCGGGGCCGG + Intronic
1176380796 21:6111324-6111346 GCTCCGCGCGGGCGCCGGGCCGG + Intronic
1179185511 21:39082815-39082837 ACTGCGCATGCGCTCTGTGCTGG + Intergenic
1179438124 21:41375878-41375900 GCTGGGCCTGTGCTCCGGGCAGG - Intronic
1179457031 21:41507314-41507336 CCTCCGCTTGCGCTCCGTGCCGG - Intronic
1179561564 21:42219133-42219155 GCTGCGCTTGGGCTCCGGCTGGG - Exonic
1179742676 21:43426916-43426938 GCTCCGCGCGGGCGCCGGGCCGG - Intronic
1180219160 21:46347024-46347046 GCAGCGTGTGGGCTCGGTGTGGG + Intronic
1180961239 22:19763301-19763323 GCTGCTCATGGACTTCGTGCCGG + Exonic
1181939495 22:26464303-26464325 GCTGCTCTTGGGCTCCATGCTGG + Exonic
1185375992 22:50482771-50482793 CCTGCGAGTGGGCTGTGTGCTGG + Exonic
950046659 3:9952211-9952233 GATGGGGGTGGGCGCCGTGCAGG + Intronic
950261164 3:11544206-11544228 GCTGCGATGGGGCTCCGGGCAGG + Intronic
954293779 3:49663093-49663115 GCCGCCCGTGGTCACCGTGCCGG - Exonic
954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG + Intronic
961655665 3:128440318-128440340 GCTGCACCTGGTCTCAGTGCTGG + Intergenic
961831186 3:129623740-129623762 GCTGGGCTGGGGCTCCGGGCTGG + Intergenic
961862228 3:129926228-129926250 GCTGCATCTGGGCTCCTTGCAGG - Intergenic
962575492 3:136752036-136752058 GCCGGGCGCGGGCCCCGTGCGGG - Intronic
962575641 3:136752588-136752610 ACTGCGCGAGCGCTCCGTGTGGG - Intergenic
962740885 3:138361987-138362009 GCAGGGCGTGGGCTCTGTGAAGG - Intronic
963236538 3:142962676-142962698 GCTGCCTGTGGCCTTCGTGCTGG - Exonic
968701115 4:2058805-2058827 GCTTCCCGGGGGCTCCGGGCCGG + Intergenic
969113908 4:4859836-4859858 GCCGGGCATGGGCTCCGGGCGGG - Exonic
980827365 4:138088981-138089003 GGTGGGCGTGGGCTCCGCGCGGG - Intergenic
985279387 4:188270462-188270484 GATGCGTGGGGGGTCCGTGCGGG + Intergenic
985441472 4:189984703-189984725 GCGGCCCCTGGGCTCCCTGCCGG - Intergenic
985607421 5:865486-865508 GCTCCGCCTGTGCTTCGTGCAGG + Exonic
986813624 5:11385034-11385056 GCCGCGCGGGGGCTCCCCGCTGG - Exonic
987114078 5:14712936-14712958 CCTGGGCGTGGGCTCCCTCCTGG - Exonic
988825269 5:34929534-34929556 GCTAGGGGTGGGCTCTGTGCCGG - Intergenic
1001617608 5:173056158-173056180 GCGGAGCGGGGGCTCGGTGCCGG - Intergenic
1002564264 5:180101027-180101049 GCTGCCAGTGGGCTCGGGGCTGG + Exonic
1005883173 6:30075278-30075300 GCTGAGCCTGGGGCCCGTGCGGG - Exonic
1007788838 6:44297532-44297554 GCCGCCCGTGGGCTTCGGGCCGG + Intronic
1008034919 6:46735360-46735382 GCTGCGCGCGGGCTGTGTCCTGG + Intronic
1010690998 6:78910838-78910860 GCTGGGTGCGCGCTCCGTGCTGG + Intronic
1012063088 6:94511983-94512005 ACTGGGCGGGGGCTCCCTGCAGG + Intergenic
1018391254 6:163343481-163343503 CCCGCGCTTGGGCTCCCTGCCGG + Intergenic
1019603499 7:1897090-1897112 GCTGCACGGGGGCACCGTGCCGG - Intronic
1019639184 7:2094090-2094112 GCTGGGCGTGTGCTCCCAGCGGG - Intronic
1024589985 7:50872779-50872801 GCTGGGCGGGGCCTCCCTGCAGG + Intergenic
1036195406 8:6708996-6709018 GCGGCACGTGCTCTCCGTGCTGG - Intronic
1038406524 8:27326352-27326374 GCTGCGCGTGGGCACCGCTTTGG + Intronic
1040915730 8:52565172-52565194 GCCTCCCGTGGGCTCCGTGCGGG + Exonic
1048822586 8:138393692-138393714 GCTAAGCATGGGCTCCGTGAGGG - Intronic
1049380037 8:142307860-142307882 GCCGGGCGTGGGCTGCGTGCAGG - Intronic
1049616423 8:143577588-143577610 CCAGCGCCGGGGCTCCGTGCTGG - Intronic
1049788517 8:144462591-144462613 GGGGCCCGCGGGCTCCGTGCCGG - Intronic
1057463803 9:95292505-95292527 GCAGCCCGCGGCCTCCGTGCTGG + Intronic
1058663079 9:107283614-107283636 GCTGCGCGGCGGCACCATGCAGG + Exonic
1062551007 9:137086502-137086524 GCTGCCCTTGGGCGCCGTCCTGG - Intergenic
1062624008 9:137434873-137434895 GCTGCCTGTGGGCTCTGTGGGGG + Exonic
1062740949 9:138175189-138175211 GCGGCCCCTGGGCTCCCTGCCGG + Intergenic
1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG + Intergenic
1189303409 X:39969302-39969324 GCGGTGGGTGGGCTCCGGGCTGG - Intergenic
1200147631 X:153934834-153934856 GCGCCGCGTGGGCGCCGGGCCGG - Intronic
1200787585 Y:7273864-7273886 CCTTCGCGTGGGCTCCGCCCGGG - Intergenic
1201759163 Y:17518864-17518886 GCAGCCCCTGGGCTCCCTGCCGG - Intergenic
1201842392 Y:18387126-18387148 GCAGCCCCTGGGCTCCCTGCCGG + Intergenic