ID: 1088885468

View in Genome Browser
Species Human (GRCh38)
Location 11:114002969-114002991
Sequence CCATTGCCACTCAGAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088885468_1088885476 18 Left 1088885468 11:114002969-114002991 CCCCTTCCTCTGAGTGGCAATGG No data
Right 1088885476 11:114003010-114003032 CCAGTCCTTGCAATGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088885468 Original CRISPR CCATTGCCACTCAGAGGAAG GGG (reversed) Intergenic
No off target data available for this crispr