ID: 1088889653

View in Genome Browser
Species Human (GRCh38)
Location 11:114034692-114034714
Sequence TTCCCATGGGACCTCCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088889642_1088889653 21 Left 1088889642 11:114034648-114034670 CCTCTGCCTCCTGAAAGGACAGG No data
Right 1088889653 11:114034692-114034714 TTCCCATGGGACCTCCGTGAGGG No data
1088889640_1088889653 26 Left 1088889640 11:114034643-114034665 CCTTTCCTCTGCCTCCTGAAAGG No data
Right 1088889653 11:114034692-114034714 TTCCCATGGGACCTCCGTGAGGG No data
1088889648_1088889653 12 Left 1088889648 11:114034657-114034679 CCTGAAAGGACAGGCATGGGGAG No data
Right 1088889653 11:114034692-114034714 TTCCCATGGGACCTCCGTGAGGG No data
1088889645_1088889653 15 Left 1088889645 11:114034654-114034676 CCTCCTGAAAGGACAGGCATGGG No data
Right 1088889653 11:114034692-114034714 TTCCCATGGGACCTCCGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088889653 Original CRISPR TTCCCATGGGACCTCCGTGA GGG Intergenic
No off target data available for this crispr