ID: 1088890262

View in Genome Browser
Species Human (GRCh38)
Location 11:114038504-114038526
Sequence TTTTAATGTAATGTATATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088890262_1088890263 -7 Left 1088890262 11:114038504-114038526 CCTTTATATACATTACATTAAAA No data
Right 1088890263 11:114038520-114038542 ATTAAAACTATACCAACTTTAGG No data
1088890262_1088890267 6 Left 1088890262 11:114038504-114038526 CCTTTATATACATTACATTAAAA No data
Right 1088890267 11:114038533-114038555 CAACTTTAGGCTGGGTGCAGTGG No data
1088890262_1088890265 -2 Left 1088890262 11:114038504-114038526 CCTTTATATACATTACATTAAAA No data
Right 1088890265 11:114038525-114038547 AACTATACCAACTTTAGGCTGGG No data
1088890262_1088890264 -3 Left 1088890262 11:114038504-114038526 CCTTTATATACATTACATTAAAA No data
Right 1088890264 11:114038524-114038546 AAACTATACCAACTTTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088890262 Original CRISPR TTTTAATGTAATGTATATAA AGG (reversed) Intergenic