ID: 1088890264

View in Genome Browser
Species Human (GRCh38)
Location 11:114038524-114038546
Sequence AAACTATACCAACTTTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088890261_1088890264 16 Left 1088890261 11:114038485-114038507 CCAGACATTAGACTAGGCACCTT No data
Right 1088890264 11:114038524-114038546 AAACTATACCAACTTTAGGCTGG No data
1088890262_1088890264 -3 Left 1088890262 11:114038504-114038526 CCTTTATATACATTACATTAAAA No data
Right 1088890264 11:114038524-114038546 AAACTATACCAACTTTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088890264 Original CRISPR AAACTATACCAACTTTAGGC TGG Intergenic