ID: 1088890264 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:114038524-114038546 |
| Sequence | AAACTATACCAACTTTAGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1088890261_1088890264 | 16 | Left | 1088890261 | 11:114038485-114038507 | CCAGACATTAGACTAGGCACCTT | No data | ||
| Right | 1088890264 | 11:114038524-114038546 | AAACTATACCAACTTTAGGCTGG | No data | ||||
| 1088890262_1088890264 | -3 | Left | 1088890262 | 11:114038504-114038526 | CCTTTATATACATTACATTAAAA | No data | ||
| Right | 1088890264 | 11:114038524-114038546 | AAACTATACCAACTTTAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1088890264 | Original CRISPR | AAACTATACCAACTTTAGGC TGG | Intergenic | ||