ID: 1088890267

View in Genome Browser
Species Human (GRCh38)
Location 11:114038533-114038555
Sequence CAACTTTAGGCTGGGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088890261_1088890267 25 Left 1088890261 11:114038485-114038507 CCAGACATTAGACTAGGCACCTT No data
Right 1088890267 11:114038533-114038555 CAACTTTAGGCTGGGTGCAGTGG No data
1088890262_1088890267 6 Left 1088890262 11:114038504-114038526 CCTTTATATACATTACATTAAAA No data
Right 1088890267 11:114038533-114038555 CAACTTTAGGCTGGGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088890267 Original CRISPR CAACTTTAGGCTGGGTGCAG TGG Intergenic