ID: 1088896831

View in Genome Browser
Species Human (GRCh38)
Location 11:114084715-114084737
Sequence CTCAAGTTAGAAATCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 128}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088896821_1088896831 7 Left 1088896821 11:114084685-114084707 CCAGATTAGACACCCTTCTCCAC 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896820_1088896831 8 Left 1088896820 11:114084684-114084706 CCCAGATTAGACACCCTTCTCCA 0: 1
1: 0
2: 1
3: 7
4: 131
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896817_1088896831 22 Left 1088896817 11:114084670-114084692 CCTGTTCCTCCAAGCCCAGATTA 0: 1
1: 0
2: 0
3: 17
4: 160
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896818_1088896831 16 Left 1088896818 11:114084676-114084698 CCTCCAAGCCCAGATTAGACACC 0: 1
1: 0
2: 1
3: 14
4: 219
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896826_1088896831 -6 Left 1088896826 11:114084698-114084720 CCTTCTCCACGTGGGGCCTCAAG 0: 1
1: 0
2: 0
3: 18
4: 231
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896819_1088896831 13 Left 1088896819 11:114084679-114084701 CCAAGCCCAGATTAGACACCCTT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896815_1088896831 29 Left 1088896815 11:114084663-114084685 CCAGAGCCCTGTTCCTCCAAGCC 0: 1
1: 0
2: 2
3: 29
4: 295
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896816_1088896831 23 Left 1088896816 11:114084669-114084691 CCCTGTTCCTCCAAGCCCAGATT 0: 1
1: 0
2: 1
3: 21
4: 236
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896825_1088896831 -5 Left 1088896825 11:114084697-114084719 CCCTTCTCCACGTGGGGCCTCAA 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128
1088896814_1088896831 30 Left 1088896814 11:114084662-114084684 CCCAGAGCCCTGTTCCTCCAAGC 0: 1
1: 0
2: 1
3: 18
4: 249
Right 1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG 0: 1
1: 0
2: 2
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088896831 Original CRISPR CTCAAGTTAGAAATCCTGGG AGG Intronic
901132367 1:6970068-6970090 CTGGGGTTAGAGATCCTGGGAGG - Intronic
903981494 1:27191904-27191926 ATCATATTAGGAATCCTGGGGGG + Intergenic
906085494 1:43129763-43129785 CAGAAGTGAGAATTCCTGGGAGG + Intergenic
909608450 1:77530190-77530212 CTCAAGTGAAAAATCCTATGTGG - Intronic
910021127 1:82591144-82591166 CTCAAGTTAGATACTCTGTGTGG - Intergenic
911030728 1:93484795-93484817 CTCAAGTTTGAGATGTTGGGAGG + Intronic
911858160 1:102908876-102908898 GTCTAGTTAGAAATACTGGCAGG + Intronic
911958357 1:104266068-104266090 AGCAAGCTAGAAAGCCTGGGTGG - Intergenic
915459628 1:156062074-156062096 CTCAAGAGAGAAGTCCTGGCCGG - Intronic
923558953 1:235023791-235023813 CTCCAGTCAGAAATCCTAGAGGG + Intergenic
1063154544 10:3366695-3366717 CTCCAGTTAGAAACCCTGCCGGG + Intergenic
1065344389 10:24734895-24734917 CTCAGGCTATAAATCCTTGGTGG - Intergenic
1066276852 10:33877370-33877392 CTCAAGTGAGAAATCCTTGGTGG + Intergenic
1071075623 10:81748022-81748044 CTCAATTTAAAAATCTTCGGTGG + Intergenic
1075338619 10:121627396-121627418 CTCCAGTGAGAAATAATGGGCGG + Intergenic
1077930433 11:6725690-6725712 CTGGATTTAGAATTCCTGGGTGG - Intergenic
1080734181 11:34994906-34994928 CCCAAGTTGGAAATACTAGGGGG - Exonic
1083555524 11:63623168-63623190 CCCAAGTTGGAAACACTGGGTGG - Intergenic
1086520953 11:87667175-87667197 CCCAAGATAGAATACCTGGGGGG + Intergenic
1088744301 11:112792627-112792649 CTCATCTTAGAAACCCCGGGTGG - Intergenic
1088896831 11:114084715-114084737 CTCAAGTTAGAAATCCTGGGAGG + Intronic
1091077488 11:132633881-132633903 CTCATGTAAGAAATCGGGGGTGG + Intronic
1095573007 12:43703909-43703931 CACAGGTTAGGAATCCTGTGTGG - Intergenic
1098576989 12:72053828-72053850 CCCAAGTTACAATTCATGGGAGG + Intronic
1099148288 12:79075787-79075809 ATGAAGATAGAAATCCTGAGAGG - Intronic
1100363985 12:93902490-93902512 CCCAAGTTAAAAATCAAGGGAGG - Intergenic
1104843419 12:131835118-131835140 CTCAGGCTAGGCATCCTGGGAGG - Intronic
1105647421 13:22336808-22336830 CACCAGTTAGAAATCCTTGTGGG + Intergenic
1109177745 13:59176780-59176802 CCCAAGTTAGGAATCTAGGGAGG - Intergenic
1111624571 13:90768217-90768239 CTCAAATTAGAAAATCTTGGGGG + Intergenic
1111643504 13:91000951-91000973 TTCAAGTTAGAAATACTAGGTGG - Intergenic
1111644492 13:91014127-91014149 ATCTATTTAGAAATCCTTGGAGG + Intergenic
1118107278 14:62674057-62674079 CTGAATTTAGACATTCTGGGGGG - Intergenic
1118284507 14:64459317-64459339 CTGAAGTTACAAATCCTGTGTGG + Intronic
1118442353 14:65823215-65823237 CTTAAGTTGGAATTCCTTGGGGG + Intergenic
1119024286 14:71140233-71140255 CTCAACTTCGGCATCCTGGGTGG + Intergenic
1119687830 14:76646780-76646802 TTCAACATAGAAATCCTGGCTGG + Intergenic
1125312993 15:38401001-38401023 CTCAAGTTGGAAAAACTGTGTGG + Intergenic
1127389549 15:58494308-58494330 CACAGGGTACAAATCCTGGGAGG + Intronic
1130505463 15:84536720-84536742 CTCTAGTTAGAACTTCAGGGAGG - Intergenic
1130941466 15:88513093-88513115 CTCAAGTTTGAGATCCAGGCGGG - Exonic
1134014813 16:10880381-10880403 CTCAAGTCAGAGACACTGGGAGG + Intronic
1135345776 16:21687348-21687370 CTCAATTTGGAAGCCCTGGGAGG - Intronic
1140837208 16:78806221-78806243 CTCATGAAAGAAATCCTGAGAGG - Intronic
1142297035 16:89230983-89231005 CACATGTTTGAAATCCTGGATGG + Exonic
1142378657 16:89720103-89720125 CGCAAGTCAGAAATCCTGCCTGG - Intronic
1144999735 17:19295790-19295812 CTCAAATTAGAATCTCTGGGAGG + Intronic
1146094807 17:29919025-29919047 CTCAAGTTATAAGTCCTTGCTGG + Intronic
1148131380 17:45264450-45264472 CTCAGGTGTGAAATCCTGGGAGG + Exonic
1150042373 17:61877667-61877689 CTAAAGTTAGAAATACTGTAAGG + Intronic
1151951982 17:77359866-77359888 CTCAAGATAGCAAACCCGGGTGG + Intronic
1153825876 18:8874583-8874605 CTCCAGGTAGAAATCCAGGAAGG - Intergenic
1154055457 18:11009142-11009164 CTCAGGGTAGGAATCCTGGTAGG + Intronic
1158079306 18:53569891-53569913 CTCATGTTAGATATCATGGGGGG + Intergenic
1158244522 18:55416392-55416414 TTCAAGCTAGAAAGCCTGGTAGG + Intronic
1159505654 18:69331991-69332013 TTCATGTTAGCCATCCTGGGGGG + Intergenic
1160288806 18:77571709-77571731 CTCAAGTTGGATATTCTGGCTGG - Intergenic
1161729188 19:5948527-5948549 GGCAAGTTAGAAAACCTGGCTGG + Intronic
1164536019 19:29087226-29087248 CCCAAGACAGAAATCTTGGGTGG + Intergenic
1164537860 19:29099643-29099665 CTCAAGTCTGGAATCTTGGGTGG + Intergenic
1165002696 19:32778254-32778276 CTCACCCTTGAAATCCTGGGTGG - Intronic
925786351 2:7434762-7434784 CTGGAGATAGTAATCCTGGGTGG + Intergenic
928283791 2:29971582-29971604 CACTAGTTGGAAACCCTGGGAGG + Intergenic
930075128 2:47400374-47400396 CTCAATTTAGAAATCTCTGGTGG - Intergenic
930714095 2:54576522-54576544 CTCAACTGACAAATCCTGGAAGG + Intronic
930980827 2:57524098-57524120 CACAAGTTTGAAATTCTGCGGGG - Intergenic
932709840 2:74054440-74054462 CCAAGGTTAGAAATACTGGGAGG + Intronic
934501728 2:94866663-94866685 TTCAGGTTAGGAATTCTGGGGGG - Intergenic
939326031 2:140689662-140689684 CACAAGATAGAGATGCTGGGTGG - Intronic
940783910 2:157961577-157961599 CTCATGTTAGAAATGCTGCCAGG - Intronic
943208929 2:184937853-184937875 CTAAAGTTTCAAATCCGGGGTGG - Exonic
944385682 2:199161451-199161473 CTCCAGTTACACATTCTGGGTGG - Intergenic
945840673 2:214884149-214884171 CACATGTTAGAAACCCTGGGGGG + Intergenic
1170013369 20:11752941-11752963 CATAAGTTTGAAATTCTGGGTGG - Intergenic
1170807088 20:19641672-19641694 CTCATGTTAGAATTACTGGGGGG + Intronic
1175292238 20:57883667-57883689 GTCAGGTTAGGCATCCTGGGCGG + Intergenic
1176624274 21:9078553-9078575 TTCAGGTTAGGAATTCTGGGGGG + Intergenic
1177426430 21:20928458-20928480 ATCAAAGTAGAAATCCTGGTTGG + Intergenic
1177999840 21:28148731-28148753 CACAAGAAAGAAATCCTGGGAGG + Intergenic
1178339823 21:31776870-31776892 CTCACATTAGAAATCCAAGGAGG - Intergenic
1178844405 21:36162449-36162471 CTCACATCTGAAATCCTGGGAGG - Intronic
1181766184 22:25093961-25093983 CCAAAGTGAGAAGTCCTGGGAGG - Intronic
1182241072 22:28916918-28916940 TACAATTTGGAAATCCTGGGCGG - Intronic
1182697788 22:32208177-32208199 CCCAAGGCAGGAATCCTGGGAGG - Intergenic
949946378 3:9193175-9193197 CTGAAGTGAGAAATCCTGAGTGG + Intronic
952454369 3:33458716-33458738 CACAAGTTAGGAACCCTGTGTGG + Intergenic
955902304 3:63770070-63770092 CTCCAGCTAGAGATCCTAGGAGG - Intergenic
957964750 3:87307714-87307736 CCCTAGTTACAAATCCTGTGTGG + Intergenic
959496165 3:107054678-107054700 CTCTAGTTAGAAAACTTGGCTGG - Intergenic
960193275 3:114732830-114732852 CTGAGGTTAGAAATACTGGAGGG + Intronic
964633449 3:158836838-158836860 CTCAAGTTGGAAATGCAGGGTGG - Intergenic
967424280 3:189308315-189308337 CACATGAAAGAAATCCTGGGAGG - Intronic
968341467 3:197959460-197959482 CTCAAGTTACAAACTATGGGTGG - Intronic
969328182 4:6455972-6455994 CTCATTCCAGAAATCCTGGGGGG + Intronic
970240444 4:14003154-14003176 TCCAAGTTTGAAATCCAGGGGGG - Intergenic
972150457 4:36083100-36083122 GTAAAGTAAGAAATCCCGGGAGG - Intronic
972915153 4:43868013-43868035 CTTAAGATAGAAATCCTTGTAGG - Intergenic
974466689 4:62266153-62266175 CTGAATTTAGAAATCTTGGCAGG - Intergenic
978349561 4:107807564-107807586 CTCAATTTAGATATCCTGGTGGG - Intergenic
978961741 4:114687864-114687886 CTCAAGAAAGAAAGCCTGGTTGG + Intergenic
979675073 4:123400803-123400825 CTCATATTTGAAATCCTGAGAGG - Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
982410814 4:155074769-155074791 CTCAAGTTAGAAATGCTTGGTGG - Intergenic
984674951 4:182536454-182536476 TTCCAGTTAGAAATCTTGAGAGG + Intronic
985135176 4:186778917-186778939 CTCAAGTCTGAAATCCAGTGGGG - Intergenic
986812633 5:11376542-11376564 CTCGAGTTAGAATTTCTGGAGGG + Intronic
986971735 5:13344773-13344795 CCCAAGTCAGATATCCTGGCTGG - Intergenic
993933622 5:93973206-93973228 TTCATGTTAGAACTACTGGGAGG - Intronic
997749029 5:136326914-136326936 CTGAGGTTAGAAGACCTGGGGGG + Intronic
1000981234 5:167819278-167819300 CCCAACTTAGATATCTTGGGAGG - Intronic
1001610344 5:172995908-172995930 CTCTAGAAAGAAATCCTGGCTGG - Intronic
1002714491 5:181217961-181217983 CTCGGGTTGGAAATCCTTGGTGG - Intergenic
1003374673 6:5564860-5564882 CACAGGTTAGGAATCCTGTGCGG + Intronic
1003700933 6:8464388-8464410 TTCAACACAGAAATCCTGGGTGG - Intergenic
1010938870 6:81892318-81892340 CTGAAGGTAGAAAGCCAGGGAGG - Intergenic
1011149926 6:84259806-84259828 CTCAAAGTAGAAATCATGGAAGG + Intergenic
1014782285 6:125578161-125578183 CTCAAGCAAGAAACCCTGTGGGG + Intergenic
1018323453 6:162637577-162637599 TTCAAGCTAGAAATTCTGTGTGG - Intronic
1023299966 7:38759571-38759593 CTCCATTTAGCATTCCTGGGAGG + Intronic
1033775168 7:144601333-144601355 CTAAAGTTGGAAATCTTGTGAGG - Intronic
1035880245 8:3238734-3238756 CTCTAATTAGATGTCCTGGGTGG - Intronic
1036921548 8:12860246-12860268 GGCAAGTTAGAAATCATGGAAGG - Intergenic
1037560876 8:20073347-20073369 CGCAAGATAGAATTTCTGGGAGG - Intergenic
1038049572 8:23796176-23796198 CTCAAGATACAAGTCCTGGCGGG - Intergenic
1040939499 8:52818077-52818099 CTCAAGCTGGAAACCCGGGGAGG + Intergenic
1047533036 8:125694560-125694582 CACCAGCTAGAAATCCAGGGTGG + Intergenic
1054773988 9:69109150-69109172 ACCAAATTAGTAATCCTGGGAGG + Intergenic
1056554724 9:87679041-87679063 CTTCAGTTCTAAATCCTGGGAGG - Intronic
1058030920 9:100196841-100196863 TTCAAGTTTGAAATTCTGAGGGG + Intronic
1059018107 9:110543944-110543966 CTTAAGTGAGAAATCCTGCTGGG + Intronic
1061297410 9:129684284-129684306 CCTAATTTAGAAATCCAGGGTGG + Intronic
1203747454 Un_GL000218v1:48985-49007 TTCAGGTTAGGAATTCTGGGGGG + Intergenic
1203562267 Un_KI270744v1:68761-68783 TTCAGGTTAGGAATTCTGGGGGG - Intergenic
1189847758 X:45152053-45152075 CACTAATTAGAATTCCTGGGTGG + Intronic
1191755864 X:64591673-64591695 ACCAAGTTCTAAATCCTGGGGGG + Intergenic
1195913226 X:109910496-109910518 CTCAAGTTAGAAATTTTAGTTGG - Intergenic
1198660883 X:138966466-138966488 CACAAGTTCGAAATCCAGTGGGG - Intronic
1199001738 X:142647044-142647066 CTCAACTTATATATCCTGAGGGG - Intergenic
1201160781 Y:11163969-11163991 TTCAGGTTAGGAATTCTGGGGGG + Intergenic
1202364491 Y:24147902-24147924 CTCTAGTTAGAACTTCAGGGAGG + Intergenic
1202506290 Y:25522220-25522242 CTCTAGTTAGAACTTCAGGGAGG - Intergenic