ID: 1088900145

View in Genome Browser
Species Human (GRCh38)
Location 11:114109606-114109628
Sequence TTAAGAGGATGGCCTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 162}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088900145_1088900155 18 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900155 11:114109647-114109669 AGGGATGAGCAACTTGGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 261
1088900145_1088900152 13 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900152 11:114109642-114109664 GTTTGAGGGATGAGCAACTTGGG 0: 1
1: 0
2: 0
3: 14
4: 141
1088900145_1088900157 20 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900157 11:114109649-114109671 GGATGAGCAACTTGGGGGTGGGG 0: 1
1: 0
2: 3
3: 26
4: 310
1088900145_1088900154 15 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900154 11:114109644-114109666 TTGAGGGATGAGCAACTTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 187
1088900145_1088900151 12 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900151 11:114109641-114109663 GGTTTGAGGGATGAGCAACTTGG 0: 1
1: 0
2: 3
3: 32
4: 283
1088900145_1088900153 14 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900153 11:114109643-114109665 TTTGAGGGATGAGCAACTTGGGG 0: 1
1: 1
2: 0
3: 30
4: 385
1088900145_1088900150 -1 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900150 11:114109628-114109650 ATCAAATAGAAATGGTTTGAGGG 0: 1
1: 0
2: 2
3: 41
4: 365
1088900145_1088900159 28 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900159 11:114109657-114109679 AACTTGGGGGTGGGGGAGATAGG 0: 1
1: 0
2: 6
3: 79
4: 646
1088900145_1088900156 19 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900156 11:114109648-114109670 GGGATGAGCAACTTGGGGGTGGG 0: 1
1: 0
2: 0
3: 17
4: 228
1088900145_1088900158 21 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900158 11:114109650-114109672 GATGAGCAACTTGGGGGTGGGGG 0: 1
1: 0
2: 3
3: 33
4: 330
1088900145_1088900149 -2 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900149 11:114109627-114109649 AATCAAATAGAAATGGTTTGAGG 0: 1
1: 0
2: 3
3: 51
4: 462
1088900145_1088900147 -9 Left 1088900145 11:114109606-114109628 CCTTGCAGAGGCCATCCTCTTAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1088900147 11:114109620-114109642 TCCTCTTAATCAAATAGAAATGG 0: 1
1: 0
2: 1
3: 20
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088900145 Original CRISPR TTAAGAGGATGGCCTCTGCA AGG (reversed) Intronic
902528440 1:17074859-17074881 TGAACATGATGGCCTCTCCATGG + Exonic
904449570 1:30602190-30602212 GAAAGAGCATGGGCTCTGCAGGG - Intergenic
904563066 1:31411700-31411722 TTAAGAGGAGGGCATCTGCCAGG + Intronic
905508725 1:38501584-38501606 TTAACAGGATTACATCTGCAAGG + Intergenic
905943192 1:41880331-41880353 TTAAGAGGATGGGCCAGGCATGG - Intronic
908770736 1:67593427-67593449 CTAAGAGGATGGCCTGTGAAAGG - Intergenic
919600919 1:199621321-199621343 TTAAGAGTGTGGCCTATGGAAGG - Intergenic
1065275619 10:24082556-24082578 AAAAGAGCATGTCCTCTGCATGG - Intronic
1068069351 10:52176933-52176955 ATAAGATCATGCCCTCTGCAAGG + Intronic
1070286167 10:75085458-75085480 TTAAGAGCAAGGACTCTGCTGGG + Intergenic
1072347457 10:94522616-94522638 TTAAGAGCATGGACTCGGCTGGG + Intronic
1075426521 10:122346103-122346125 ATAAGAGGATGGCCACTAAAGGG + Intergenic
1076423630 10:130351792-130351814 CTAAGAGAGTGGCCTGTGCAGGG + Intergenic
1077848491 11:6051124-6051146 CTAAGAGGAGGGCCCCTGCAAGG - Intergenic
1077879391 11:6336458-6336480 ATAAGATGATGTCCTTTGCAGGG - Intergenic
1079410518 11:20183111-20183133 TTAAAAGGGAGCCCTCTGCAGGG + Intergenic
1081294905 11:41373549-41373571 TTGACAGGATTGCTTCTGCATGG + Intronic
1083705343 11:64510384-64510406 TAAAGCTGCTGGCCTCTGCATGG - Intergenic
1085280855 11:75329505-75329527 TTAACAGGAGGGGCTCTGCAAGG - Intronic
1085735454 11:79034989-79035011 TTTAGGGGATGTGCTCTGCAAGG - Intronic
1086798004 11:91133188-91133210 TTAATAGGATGGCGTAGGCATGG - Intergenic
1088585247 11:111355440-111355462 AGAAGAGGATGCTCTCTGCATGG + Intronic
1088900145 11:114109606-114109628 TTAAGAGGATGGCCTCTGCAAGG - Intronic
1089774757 11:120828485-120828507 TTAAGAAGATGGCAACTACAAGG - Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090053459 11:123401426-123401448 TTAAGAGCATGTGCTCTGCACGG - Intergenic
1092383462 12:8017841-8017863 TTAAGAGCATGGCATCGGCTGGG + Intergenic
1095859083 12:46894858-46894880 TTAAGAGCATGGTCTCTGGGGGG - Intergenic
1101678611 12:106942837-106942859 TTAAGAGGATCCCTTCTACATGG - Intergenic
1101990107 12:109477389-109477411 TTAAGACGTTGCCCTCTGCGGGG - Exonic
1102201590 12:111061106-111061128 ATCAGCGGCTGGCCTCTGCAGGG - Intronic
1102707511 12:114895178-114895200 TTAAGAACATTGCTTCTGCATGG - Intergenic
1103973676 12:124688282-124688304 TCAAGAGTCTGGCCTCTGGAGGG - Intergenic
1104657141 12:130581736-130581758 TTATGAGAATGGCCTCTCAATGG + Intronic
1105228428 13:18461557-18461579 TTAAGAGTATATCATCTGCAAGG - Intergenic
1106309372 13:28540451-28540473 GTAAGAGGATGGCTTCAGCCCGG - Intergenic
1107092026 13:36491840-36491862 CTAAGAGGATGGGCTCAGTAAGG + Intergenic
1108145858 13:47476204-47476226 TTAACAGGATTGCCTCTCCGTGG - Intergenic
1108946049 13:56025691-56025713 CCAAGAGGATGGAATCTGCAAGG - Intergenic
1113185436 13:107681718-107681740 TTGAGAGGATGGCCTCCCCTAGG - Intronic
1113639835 13:111949427-111949449 GTAAGAGGGTGTCCACTGCATGG + Intergenic
1114258680 14:21022788-21022810 GTAGAAGGATGGCCTCTGCTTGG - Intronic
1114460775 14:22884897-22884919 TCAAAAGGATGGCATCTTCAAGG + Exonic
1117878530 14:60282403-60282425 TTAAGTTGATGGCCACTGCCAGG + Intronic
1121020160 14:90575133-90575155 TTAAGAGGAAGGTGTCAGCAGGG - Intronic
1121570386 14:94942623-94942645 ATAAAAGGATGGCCTCTGAGGGG - Intergenic
1123186375 14:106521253-106521275 TTCAGTGGCTGGCCCCTGCAGGG - Intergenic
1123727028 15:23113259-23113281 TGAAGAGAATGGCCTCTGCTGGG + Intergenic
1123893674 15:24806953-24806975 TGAAGAGAATGGACTCTGGAGGG - Intergenic
1125387226 15:39150951-39150973 TCAAGAGAATGGCCTTTGCTTGG - Intergenic
1125476879 15:40053769-40053791 TTCAGAGGCAGGGCTCTGCAAGG - Intergenic
1125718602 15:41834419-41834441 CTAGGAGGCTGGCCTCTCCAGGG + Intronic
1126526919 15:49666406-49666428 ATAAGAGCATGTCCTTTGCAGGG - Intergenic
1127827491 15:62717853-62717875 TTAAGTGGATGGCCTGTGTTTGG + Intronic
1132354751 15:101163010-101163032 TTGAGAGGCTGGCCTCCGGAGGG - Intergenic
1133564584 16:6981406-6981428 ATAAGATGATGTCCTTTGCAGGG - Intronic
1137596294 16:49726222-49726244 TTAAGAGGCTGGCAGCTGGAGGG - Intronic
1138227485 16:55309956-55309978 TTAAGAGCATGAACTCTGTAGGG - Intergenic
1138978802 16:62241387-62241409 TGATGTGGATGGCCACTGCAGGG + Intergenic
1140350858 16:74260863-74260885 TTAAGATGATGGACTCTGGTAGG - Intergenic
1140553418 16:75892754-75892776 TTAAGAGAATGGGCTGTGTAGGG - Intergenic
1142662511 17:1441027-1441049 GTAAGAGGATGGCTTCAGCCTGG - Intronic
1144351694 17:14403033-14403055 TGCAAAGGATGGTCTCTGCAGGG - Intergenic
1145752316 17:27364005-27364027 TTAAAAGAAAGGCCTCTGCCAGG - Intergenic
1145923993 17:28632485-28632507 TTAAGAGGTGGGCCTCTGGGAGG + Intronic
1145927669 17:28659728-28659750 ATATGAGGAGGGCCTCTGCCCGG - Intronic
1147320580 17:39643461-39643483 TTAAGGAGATGGTGTCTGCATGG + Intronic
1151267531 17:72968230-72968252 TTAAAAGGAAGGCATCTGCGAGG + Intronic
1151301348 17:73229573-73229595 TTAAGAGTATGGGCTGGGCACGG + Intronic
1151428622 17:74047809-74047831 TGGAGTGGATGGCCTCTCCATGG - Intergenic
1152173094 17:78766861-78766883 TTCAAAGCATGGCCTGTGCATGG + Intronic
1153337220 18:3937073-3937095 TTCAGAAGCTGGCCTCTCCAGGG - Intronic
1153999021 18:10467811-10467833 TCAAGTGGATGCCCTCTACAGGG - Intronic
1156228325 18:35130475-35130497 GGAAGAGGATGGACACTGCATGG + Intronic
1156423420 18:36980846-36980868 TTAAGGGGATGGCCTGTGGCAGG - Intronic
1156583962 18:38410937-38410959 TTTAAAGGATGGCCTCTGAAAGG + Intergenic
1157731523 18:50008382-50008404 TTAAGAGGAAGTCCTCAGCAAGG + Intronic
1163359167 19:16834836-16834858 TTCAGACGATGGCCTCTCAAAGG - Intronic
1164966497 19:32489415-32489437 TTAAGGGGAAGGGCTCTGCAGGG + Intergenic
1166145537 19:40832243-40832265 TTAAGAGCATAGCCTCAGCTGGG + Intronic
927503870 2:23600673-23600695 TTAAGTGGATGTCTTCTGGAGGG + Intronic
931228280 2:60352498-60352520 TTCAGAGGATGGAGACTGCATGG - Intergenic
933113436 2:78434316-78434338 TTGAGAGGTTGGCCTTTACACGG - Intergenic
935503004 2:103865111-103865133 TTAAGAAAATAGACTCTGCAAGG - Intergenic
937320622 2:120958624-120958646 TGGAGAGGAAGGCCTCTGGACGG - Intronic
937815998 2:126251349-126251371 GTAAGAGGAAGGGCACTGCAGGG + Intergenic
938194441 2:129314467-129314489 TTAGCAGGATTGCCTCTGGAGGG + Intergenic
938747214 2:134290854-134290876 TCAAGTGGATTCCCTCTGCATGG - Intronic
938983138 2:136545832-136545854 TTCAAAGGATGGCTCCTGCATGG - Intergenic
940049517 2:149447519-149447541 TGAAGAGGGTCACCTCTGCATGG + Intronic
941418967 2:165258763-165258785 ATAAGATTATGTCCTCTGCAGGG + Intronic
942554042 2:177152923-177152945 TTAAGAGTAAGGCCTCGGCCAGG + Intergenic
942735599 2:179108300-179108322 TTCAGAGGATAGCATCTTCAAGG + Exonic
943670633 2:190656610-190656632 TTAAGAGAAAGCCCTCTGCATGG - Intronic
943800289 2:192049235-192049257 TTAAGAGCATGGAGTCTGCCTGG + Intronic
945888456 2:215402226-215402248 TTAAGATGATGCTCTCTGCCTGG + Intronic
947069711 2:226274687-226274709 TGATGAAGATGGCCTCTTCAAGG + Intergenic
948831222 2:240599192-240599214 GGATGAGGATGGCCTCTGGAGGG + Intronic
1171062616 20:21981167-21981189 TTAATAAGAGGGGCTCTGCAAGG - Intergenic
1174511646 20:51057946-51057968 TGAAGAGGAATGCCTCTTCAGGG + Intergenic
1175507861 20:59498783-59498805 TTAAGAGCCTGACTTCTGCAGGG + Intergenic
1175775679 20:61652036-61652058 TTTAGAAGATGGCCTCGGCCAGG + Intronic
1178505322 21:33157950-33157972 TTGAGACGATGGCATCTGCCTGG + Intergenic
1178604127 21:34020464-34020486 TTAGAAGGGTGGCCTCTGCAGGG - Intergenic
1179187816 21:39098095-39098117 TTAACGGGAAGGGCTCTGCAAGG - Intergenic
1179192496 21:39135492-39135514 GTAAGTGGATGTTCTCTGCAGGG + Intergenic
1179513706 21:41892061-41892083 TTAAGTTGATGACTTCTGCAAGG - Intronic
1180664816 22:17502268-17502290 TTAAGAGCATGGGCTCCGAAGGG - Intronic
1181042866 22:20201035-20201057 TTAAGAGGATGCCCTATGGCCGG + Intergenic
1182153610 22:28048809-28048831 TCAAGAGAATGGCCTAGGCAAGG - Intronic
1182639222 22:31753528-31753550 TTAGGGTGATGGCCTCTGCTGGG - Intergenic
1184147092 22:42618048-42618070 GTCAGAGGATGCCATCTGCATGG - Exonic
951506076 3:23446265-23446287 TAAAGAGGATGTTCTCAGCATGG + Intronic
953548390 3:43881765-43881787 TCAAGAAGAAGGCCTTTGCATGG + Intergenic
955393313 3:58536755-58536777 TAAAGAGGGTGGCCTCTTTAAGG - Intronic
956717101 3:72088259-72088281 TTGAGTGGGTAGCCTCTGCAGGG - Intergenic
957263202 3:77926892-77926914 TGAAAAGGATGTCCTCAGCATGG + Intergenic
960249626 3:115437753-115437775 TTAGGAGGATGGCCTCCTAATGG - Intergenic
960293614 3:115915989-115916011 AAAACAGGATGGCCTTTGCAAGG - Intronic
961557530 3:127706874-127706896 TTAAGTCGAAGGCCTCAGCACGG + Intronic
962731012 3:138283563-138283585 TTATGGGTATGCCCTCTGCAGGG - Intronic
966201021 3:177359690-177359712 CTAAGAGGAAGGCCCCTGCAGGG + Intergenic
966289458 3:178338468-178338490 AGAAGAAGATGGCTTCTGCAGGG - Intergenic
966492394 3:180542477-180542499 TTAACAGAAGGGCCTCTTCAGGG - Intergenic
966864480 3:184249687-184249709 TTGAGAGCATGGCCTCTCCAGGG + Exonic
967242262 3:187451581-187451603 TTATTAGGATGGCCACTTCAGGG - Intergenic
967565689 3:190968880-190968902 TTAAGAAGATTACCTCTGGAGGG - Intergenic
968270347 3:197398762-197398784 TAAAGAGGTTGGCACCTGCATGG + Intergenic
968967313 4:3775662-3775684 TTAAAGGGCTGGACTCTGCAGGG + Intergenic
970825398 4:20266899-20266921 TAAAGAGAACTGCCTCTGCAGGG + Intronic
971235296 4:24836459-24836481 TCAAGAGGTTGACCTCTTCATGG + Exonic
971748641 4:30617483-30617505 TTATGTGGATTACCTCTGCAAGG - Intergenic
972607764 4:40629910-40629932 TGAGGCGGATGGCCTCGGCAGGG - Intronic
975917138 4:79339132-79339154 TTAAGAGTCTGGGCACTGCATGG + Intergenic
981036722 4:140177078-140177100 CTGAGTGGATGGCCTCTTCAGGG + Intergenic
981244157 4:142514573-142514595 TTAAGAGCATGGGCTATGAATGG + Intronic
981583338 4:146272708-146272730 TTAAGTGGATGGGCTCTCCTGGG + Intronic
985220724 4:187701463-187701485 TTAAGAGCATGGTCTCTGTCTGG - Intergenic
986210845 5:5670464-5670486 ATGAGATCATGGCCTCTGCAGGG - Intergenic
986752082 5:10796228-10796250 TTAAGAGGTTGGCCTTTGGGAGG - Intergenic
990301047 5:54449850-54449872 GTAACAGGATGGCATCTTCAAGG - Intergenic
991371296 5:65923478-65923500 TTAAGAGGATGGAATCTGGCCGG - Intergenic
991580795 5:68153089-68153111 TTAAGGACATGGACTCTGCAAGG + Intergenic
999642761 5:153688650-153688672 TTAAGAGTACTGCCTCTGGAAGG + Intronic
1000038010 5:157463403-157463425 CTAAGAGGATGGCCTCAGCAAGG + Intronic
1001604536 5:172950608-172950630 ATGAGATGATGGGCTCTGCAAGG - Intronic
1010318265 6:74475598-74475620 ATAAGACCATGTCCTCTGCAGGG + Intergenic
1010567395 6:77432365-77432387 TTAAGAGGATGGAATCTGGTAGG - Intergenic
1017232442 6:152087680-152087702 TTAAGAGGATGATCTATCCATGG - Intronic
1017449587 6:154541996-154542018 TTAAGAGAATGGGCTCAGCCGGG - Intergenic
1018761562 6:166898371-166898393 CTAAAAGGATGGCCTCTGCTTGG + Intronic
1024853635 7:53750628-53750650 TTAAGAGCATGACCTATGAAAGG - Intergenic
1026147907 7:67763817-67763839 TTAAAATGAAGGCCTCTGCCAGG - Intergenic
1028102436 7:86837633-86837655 TGAAGAGGAGGGCCTAGGCAGGG + Intronic
1028656103 7:93208787-93208809 CAAATAGGATGGCCTCTCCAAGG + Exonic
1031386902 7:121162371-121162393 TTAAAAGGGAAGCCTCTGCAAGG + Intronic
1033266441 7:139891154-139891176 ATAAAAGGATGCCCACTGCAGGG - Intronic
1034122010 7:148636759-148636781 CAATGAGGATGGCCTCTCCAGGG + Intergenic
1035965826 8:4190778-4190800 ATGAGAGCATGTCCTCTGCAGGG + Intronic
1036967570 8:13317741-13317763 TTAAGAGGATTGCATTTTCAAGG + Intronic
1042554689 8:70023989-70024011 TTGAAAGGATGGCCTCTGCAAGG - Intergenic
1044464689 8:92489452-92489474 TTGAAAGCATGGCCTTTGCAGGG - Intergenic
1045074403 8:98547130-98547152 TGAAGAGTATTGCCTCTCCATGG - Intronic
1046449544 8:114370678-114370700 TTAAGATAATGGCCTCGGCCGGG - Intergenic
1051912381 9:22168859-22168881 TTAAAAGGAAGGTCTCTGGATGG + Intergenic
1053368153 9:37538410-37538432 TTAAAAGCATGGGCTCTGCCAGG + Intronic
1056242793 9:84666379-84666401 TTAGGTAGATGGCCTCTGCCTGG + Intergenic
1058459760 9:105172121-105172143 TTAAGAGGAAAGCCATTGCATGG - Intergenic
1058946304 9:109859949-109859971 TTCAGTGGATGGACACTGCAGGG + Intronic
1062082530 9:134631870-134631892 TTAAGCTGATTGCATCTGCACGG - Intergenic
1187519224 X:19999044-19999066 TTAAAATTATGGCCTCTGCCAGG - Intergenic
1189147595 X:38671311-38671333 TTAAGAAGAGGGCTTCTTCAGGG - Intronic
1193091657 X:77500386-77500408 ATGAGAGGATGTCCTTTGCAGGG + Intergenic
1195070216 X:101272044-101272066 TTATGAGGATGGGCTTAGCATGG - Intronic
1195646880 X:107242024-107242046 TTTAAAGGATGGACTCTACACGG + Intronic
1195995748 X:110730044-110730066 GTAAGAGGATGGCCACTGTAAGG - Intronic
1196098417 X:111823933-111823955 TTAAGAGTATGCCCTTGGCAGGG + Intronic
1196777389 X:119351992-119352014 ATAAGATCATGTCCTCTGCAGGG + Intergenic
1196939065 X:120757973-120757995 TTAAGAGGAGGGCTTTTGGAAGG + Intergenic
1198429682 X:136553148-136553170 TTAAGAGCATGGGCTTTGCTGGG - Intronic
1198871724 X:141182954-141182976 TTAAGAGTATGGGCTCTGGATGG - Intergenic