ID: 1088900627

View in Genome Browser
Species Human (GRCh38)
Location 11:114114194-114114216
Sequence GTCCATGTCGGCCACAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088900627 Original CRISPR GTCCATGTCGGCCACAATGT TGG Intronic
900921279 1:5672297-5672319 GTCCATGTCTGCAGCAATATTGG + Intergenic
905661811 1:39733122-39733144 GTCCAAGTCTGCCAAAATCTAGG - Intronic
1084874004 11:72117316-72117338 GTCCAGGGAGGCCACAATGATGG - Intronic
1088900627 11:114114194-114114216 GTCCATGTCGGCCACAATGTTGG + Intronic
1091757250 12:3062109-3062131 GTCCATGTCTCTAACAATGTTGG + Intergenic
1096590198 12:52653163-52653185 GTCCATGTGGCCAACTATGTGGG + Intergenic
1112675815 13:101700343-101700365 GTATATGTGGGACACAATGTTGG - Intronic
1114317764 14:21523765-21523787 CTCCATGTTGGCCATAATGAAGG + Exonic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1135795251 16:25435192-25435214 GACCATGTCTGCCACAATTTTGG + Intergenic
1139093134 16:63673632-63673654 GTCAATGCCGGTCACAGTGTAGG + Intergenic
1160555318 18:79720862-79720884 GTCCAGCTTGGCCACAGTGTTGG + Intronic
1161866163 19:6833600-6833622 GCCCATGTCGGCCACATGGAGGG - Exonic
1167942606 19:52959772-52959794 GTGCATGACTGCCACATTGTGGG - Intronic
926424185 2:12726396-12726418 CTCCATGTAGGCCACCATGCAGG - Intronic
932116578 2:69055426-69055448 CTCCATGTTGGTCACAATGATGG + Intronic
937705091 2:124911388-124911410 TTCCAGGTGGGCCACACTGTAGG + Intronic
946638580 2:221757865-221757887 CTCCATCTCTGCCACAGTGTTGG - Intergenic
947704436 2:232262835-232262857 GTCCCTGTCTGCCACATTGTTGG + Intronic
1171902928 20:30873579-30873601 GTCCATGTCTGCAGCAATATTGG + Intergenic
1173180044 20:40799399-40799421 GTCCATGAAGTCCAAAATGTTGG + Intergenic
1174367033 20:50062745-50062767 CTCAATGTCGGCCACATTCTGGG + Intergenic
1174587670 20:51621551-51621573 GTCAATGTCTGCCACAAGGGCGG + Intronic
1180318897 22:11303025-11303047 GTCCATGTCTGCAGCAATATTGG - Intergenic
1180336320 22:11579549-11579571 GTCCATGTCTGCAGCAATATTGG + Intergenic
1180836972 22:18934783-18934805 CTCCATCCCGGCCACAAGGTGGG + Intronic
1181805174 22:25370250-25370272 CACCATGTTGGCCACCATGTTGG + Intronic
1182410243 22:30179274-30179296 GTCAAGGTCTGCTACAATGTAGG + Intergenic
1184734072 22:46387920-46387942 GTCCACGGCGGCCTCAGTGTGGG - Intronic
1203287065 22_KI270734v1_random:160082-160104 CTCCATCCCGGCCACAAGGTGGG + Intergenic
950624924 3:14238284-14238306 GTCCATGATGCCCAAAATGTTGG - Intergenic
962577387 3:136767406-136767428 GTCCAGGCCGGACACAATCTTGG - Intergenic
965734379 3:171805359-171805381 GACCCAGTCGGCCATAATGTGGG + Intronic
966479433 3:180389444-180389466 AGCCATGTCAGCCACAATTTGGG - Intergenic
968750314 4:2385557-2385579 GGCCATGTAGGCAACCATGTAGG - Intronic
995442773 5:112210610-112210632 GCCCATGGCAGACACAATGTTGG + Intronic
998057167 5:139087984-139088006 ATCCATGTCCACCATAATGTAGG + Intronic
998331648 5:141332690-141332712 GCCCAGGTCGGCCAGGATGTCGG - Exonic
998332476 5:141340977-141340999 GCCCAGGTCGGCCAGGATGTCGG - Exonic
998333032 5:141346039-141346061 GCCCAGGTCGGCCAGGATGTCGG - Exonic
998336443 5:141376089-141376111 GCCCAGGTCGGCCAGGATGTCGG - Exonic
1003094600 6:3132383-3132405 CCCCATGTGGGCCACAGTGTTGG + Intronic
1004505972 6:16246900-16246922 GTCCATGTTGGCCACGATGATGG - Exonic
1007481505 6:42153453-42153475 GGCCATGTCAGCCTCACTGTGGG - Intergenic
1012830951 6:104202671-104202693 GTCCAAGTCAGACAAAATGTAGG - Intergenic
1012887353 6:104860590-104860612 GTTCATTTCTTCCACAATGTAGG - Intergenic
1013184692 6:107747169-107747191 GTCCATGTGGGCCACCATAATGG - Intronic
1029092378 7:98058260-98058282 GACCATGTAGGACCCAATGTGGG + Intergenic
1042625181 8:70749286-70749308 CTCCATGCCTGCCACATTGTGGG + Intronic
1044970855 8:97618206-97618228 GGCCCTGTGGGCCACAAAGTAGG - Intergenic
1047109165 8:121769375-121769397 GTTCATGTTGACCAAAATGTTGG - Intergenic
1188706190 X:33334467-33334489 GACCATGTGGGCCACAAAGCAGG - Intronic
1198431105 X:136567125-136567147 GGCCATTTCTGCCCCAATGTGGG + Intergenic