ID: 1088902312

View in Genome Browser
Species Human (GRCh38)
Location 11:114127571-114127593
Sequence GCTTTTCAGGTGCTTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088902312 Original CRISPR GCTTTTCAGGTGCTTGTGGA TGG Intronic
900523900 1:3119243-3119265 CCTTTCCAGGTGCTGGTGAAGGG + Intronic
902237177 1:15064895-15064917 AACTTTCAGGTGCTTGTTGAGGG - Intronic
902276811 1:15345869-15345891 GCTTTTAGGATGCTGGTGGAGGG - Intronic
903564946 1:24258197-24258219 GCTTTTTAGGTAGTTGTGGATGG + Intergenic
904274868 1:29374958-29374980 GGTTTTCAGTGGCTTATGGATGG + Intergenic
904663958 1:32105840-32105862 GCTTTTCAGGAGATAGTGGGTGG + Intergenic
905320067 1:37109710-37109732 GCCTTTCATGTGCTAGTGCAGGG + Intergenic
906203602 1:43975275-43975297 GATTTCCAGCTGCTTGAGGAGGG + Intronic
908840654 1:68276928-68276950 ACTTTTTAAGTGCTTCTGGATGG + Intergenic
911499990 1:98673669-98673691 GCTTTTCATGTGCACATGGATGG + Intronic
913136236 1:115892001-115892023 GCTATTCAGGAGCTTGAGGTGGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
918285834 1:183054126-183054148 GATTTTCAGGTGCATTTGTAAGG + Intronic
920199597 1:204251471-204251493 CCATTTCAGCTGCTTGTGCATGG - Intronic
920303030 1:205001159-205001181 GCTCATCAGGGGCTGGTGGACGG - Exonic
920532462 1:206713752-206713774 GCTAGTCAGGTGCTTGAGGTGGG + Intronic
924026201 1:239835372-239835394 ACTCATCAGTTGCTTGTGGAAGG - Intronic
1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG + Intronic
1068917473 10:62447794-62447816 GCCTTTCAGGTCGTGGTGGATGG + Intronic
1069310599 10:67030890-67030912 GCTACTCAGGTGGTTGAGGAAGG + Intronic
1069602431 10:69716672-69716694 GCTTTTCAGGTGACTGTGATGGG + Intergenic
1069927550 10:71861499-71861521 GCTATTCAGGAGGTTGAGGAAGG - Intergenic
1073458366 10:103651278-103651300 GCTTACCAGGTCCTTGGGGAGGG - Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1078611230 11:12821168-12821190 GCTTTTCAAGGGCCTGTGTATGG + Intronic
1078844328 11:15107824-15107846 GCTTCTCAGGTCCTTCTGGAAGG - Intergenic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1081936966 11:46911631-46911653 ACTTCTCAGGTGCTTCTTGAGGG - Intronic
1088902312 11:114127571-114127593 GCTTTTCAGGTGCTTGTGGATGG + Intronic
1089789404 11:120931919-120931941 GCTTTTCAGGGGCTGTGGGAAGG - Intronic
1090067064 11:123512085-123512107 GCTATTCAGATGTTTGTGGAAGG - Intergenic
1093929203 12:24938024-24938046 TATTTTAAGGTGCATGTGGATGG - Intronic
1098011299 12:66055628-66055650 GCTTTTCAGGAGGTTGAGGCAGG - Intergenic
1099564264 12:84220862-84220884 TCTTTTCAGGTTCCTTTGGAAGG + Intergenic
1100054601 12:90493359-90493381 CCTTTTCAGGTGAATGTGGCAGG + Intergenic
1100717593 12:97322171-97322193 GCTTTCCAGGTGCGTGGGGGTGG + Intergenic
1101004272 12:100386469-100386491 GGTTGTCAGGTGCTGGGGGAGGG - Intronic
1102757233 12:115352085-115352107 GGTTTTCAGGGGCTAGTGGAGGG - Intergenic
1102864238 12:116361399-116361421 GCTCGGCAGGTGCTTGTGGTTGG - Intergenic
1103472632 12:121194016-121194038 CCTTTTCAGGAGCTTGTCTATGG + Intergenic
1103804138 12:123559318-123559340 GCTATTCAGGAGGTTGAGGAGGG + Intergenic
1105756040 13:23465496-23465518 GTTTTTCAGGAGCTAGGGGAAGG + Intergenic
1106221661 13:27750872-27750894 GCTATTCAGGTGCTTGCTTAAGG + Intergenic
1106454858 13:29918372-29918394 GCTCTTCAAGTCCTTGTGGGAGG - Intergenic
1108523228 13:51263191-51263213 GCTTTTCAGGAGCAGATGGACGG - Intronic
1109212014 13:59545839-59545861 GCTTTTTAGGGGCTGGTGTAGGG + Intergenic
1111516252 13:89335552-89335574 GGGTTGCAGGTGCTTGTAGAGGG + Intergenic
1112066520 13:95798901-95798923 GCTTTTCAGGTGCTGGAGTCAGG + Intergenic
1114145353 14:19969891-19969913 GGTTTCCAGGTGTTTGAGGAGGG + Intergenic
1116734334 14:48670390-48670412 TCTTTTCAGATACTGGTGGAGGG + Intergenic
1116832344 14:49733537-49733559 GCTACTCAGGTGCCTGAGGAAGG - Intronic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117895883 14:60485931-60485953 GCTGTTTAGGTGCGTGTGGAAGG - Exonic
1118666820 14:68078876-68078898 GCTATTCAGGAGGTTGTGGTGGG + Intronic
1118682475 14:68257180-68257202 GGTTTCCAGGAGCTTGGGGAAGG + Intronic
1119087919 14:71754082-71754104 GCCTCTCAGGTGTTGGTGGAGGG - Intergenic
1119742140 14:77020826-77020848 GCTATTCAGGAGGTTGAGGAGGG - Intergenic
1120015177 14:79465263-79465285 GCTTTGAGGGTGTTTGTGGATGG + Intronic
1120864385 14:89283589-89283611 GCTTTTGAGCTGCCTGAGGATGG - Intronic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1122474933 14:102000973-102000995 GCTTTTCAGCTGGTTCAGGAGGG - Exonic
1125085460 15:35724488-35724510 GCTTATCAGGTCTTTGTGGCAGG - Intergenic
1125408376 15:39378585-39378607 GATTTTCAGGTCCTAGGGGATGG - Intergenic
1126978183 15:54209522-54209544 GCTATTCAGGAGATTGAGGAGGG - Intronic
1127799970 15:62469678-62469700 GCTTTAAGGGTGCTTGTGGGTGG - Intronic
1128040326 15:64566694-64566716 TGTCTTCAGCTGCTTGTGGAGGG + Intronic
1128661590 15:69505161-69505183 GCATTTCAGGAGCTAGTAGAGGG - Intergenic
1129125388 15:73436172-73436194 GCTTTCCAGGGGCTTGGGGGAGG + Intergenic
1129266049 15:74393673-74393695 GCTGTGCAGGTGTTTGGGGAAGG - Intergenic
1131642368 15:94306272-94306294 ACTTGTTAGGTGCTTGTGGCTGG - Intronic
1134798103 16:17060064-17060086 GGTTTCCAGGGGCTTGGGGAAGG + Intergenic
1134869363 16:17637947-17637969 GAGTTCCTGGTGCTTGTGGAAGG + Intergenic
1136050931 16:27649385-27649407 GCTTAACAAATGCTTGTGGAAGG - Intronic
1136179743 16:28542859-28542881 GCTTTTAAGGGGATTATGGAGGG + Intergenic
1136710945 16:32235739-32235761 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1136756963 16:32693672-32693694 GCTTGTCAGGAGCATGGGGATGG - Intergenic
1136811146 16:33176703-33176725 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1136817622 16:33286783-33286805 GCTTGTCAGGAGCATGGGGATGG + Intronic
1136824186 16:33343312-33343334 GCTTGTCAGGAGCATGGGGATGG + Intergenic
1137523318 16:49212100-49212122 GCTTTGCAGGGCCTTGTGGATGG - Intergenic
1139784921 16:69385460-69385482 GCTTGTCAGGCCCTTGGGGAAGG - Exonic
1140047034 16:71446794-71446816 GCTTTTCAGGTCCTGAAGGAAGG - Intergenic
1140840896 16:78838166-78838188 GCTTTTCAGGTTGTGGTGGGTGG + Intronic
1141138237 16:81480610-81480632 GTTTTGCAGGTGATTTTGGAAGG + Intronic
1141482818 16:84318222-84318244 GTTTCTCAGCTGCTTGAGGAGGG + Intronic
1142253863 16:89004582-89004604 AGTTTTCAGGTGCAGGTGGAGGG + Intergenic
1203059112 16_KI270728v1_random:954023-954045 GCTTGTCAGGAGCATGGGGATGG - Intergenic
1142567132 17:847688-847710 TCATTTCAGGAGCTGGTGGAGGG - Intronic
1144523575 17:15970884-15970906 GCTTTTGATGCTCTTGTGGAAGG - Intronic
1146229126 17:31093384-31093406 GCTATTCAGGAGCTTGAGGTGGG + Intergenic
1146498455 17:33343860-33343882 GCTTTTCAGGGGCTTCTGTGGGG - Intronic
1147160702 17:38568011-38568033 GCCTGTCAGGGGCTTGTGGATGG - Intronic
1148972311 17:51494502-51494524 GCTTTTAAGGGGATTATGGAAGG + Intergenic
1149041120 17:52189509-52189531 GTTTTCCAGGTGCTGGTGGAAGG - Intergenic
1151282831 17:73089383-73089405 GATTGTCTGGGGCTTGTGGAAGG - Intronic
1152260059 17:79261916-79261938 CCTTTACTGGGGCTTGTGGAGGG + Intronic
1154462486 18:14607539-14607561 GGTTTCCAGGTGTTTGAGGAGGG + Intergenic
1156473783 18:37393420-37393442 GCTGCTCAGGAACTTGTGGACGG + Intronic
1160076214 18:75680110-75680132 GCATTTCAGGGGCATGTGGAGGG - Intergenic
1160761487 19:787652-787674 GCGGCTCAGGTGCTTGTGCAAGG - Intergenic
1161671440 19:5613514-5613536 GTTTTTCAGGTGGATGGGGAAGG - Exonic
1165074170 19:33271597-33271619 GCTTTTCAACTGCTTTTGCAGGG + Intergenic
1168470804 19:56639124-56639146 GCTATTCAGGAGCCTGAGGAAGG - Intergenic
924982043 2:232371-232393 GATTTTCAGATGTTTGTGGAAGG - Intronic
925691978 2:6534698-6534720 CCTTTTCAGGCCCTTGTTGAAGG - Intergenic
926572068 2:14540553-14540575 GCTTGTCAGGAACTAGTGGAGGG + Intergenic
926960345 2:18351307-18351329 GCTTTTCATTTGCTTGTAGTGGG + Intronic
927124193 2:19998370-19998392 GCTTTTCCGTTGCTAGTGGTAGG - Intronic
927750053 2:25660406-25660428 GGTTTCCAGGGGTTTGTGGAGGG + Intronic
929092115 2:38229066-38229088 TCTTTTCATGTGCTTCTGTATGG - Intergenic
929853659 2:45616519-45616541 GTTTGCCAGGTGCTGGTGGAAGG - Intergenic
930782384 2:55235419-55235441 GCTTTTCAGGTGGATGAGAATGG + Exonic
930864322 2:56107924-56107946 GCTTTTCATGTGGTGGTGCAGGG - Intergenic
930873234 2:56187398-56187420 ACTTTTCAGGGGCCTGTGGCCGG + Intronic
931706410 2:64950081-64950103 ACCTTTCAGGTCCTAGTGGAAGG - Intergenic
935229668 2:101084675-101084697 GCTTTTCAGGACCTGGGGGAAGG - Intronic
936071985 2:109377174-109377196 GCTTTTCAGGGGCATGTGATGGG + Intronic
936075447 2:109398737-109398759 GCCTTTCAGCGGCGTGTGGATGG + Exonic
936226397 2:110657564-110657586 GCTTTTCATGTGTTTGAAGATGG - Exonic
937283957 2:120738053-120738075 GCTTTGCAGTTGCTTGTTTAGGG + Intronic
938321407 2:130368344-130368366 CCTTTTCAGGAACTTTTGGATGG + Intronic
939861124 2:147421801-147421823 GTTTTACAGGTGCCTCTGGATGG - Intergenic
939956708 2:148533406-148533428 GCTTACCAGGTGCTTCTGGCTGG - Intergenic
941982094 2:171469915-171469937 GCTATTCAGGAGGTTGTGGCAGG - Intronic
942540961 2:177015307-177015329 GCTTTTCAGTTTCTTGTTCAAGG - Intergenic
1169710421 20:8555443-8555465 GCATTTCAGGTAGTGGTGGATGG - Intronic
1171101524 20:22388302-22388324 CCTTTTAAGTTGCTTGGGGATGG + Intergenic
1173148774 20:40548055-40548077 GCTTTTTAAGTGCTTGGAGAGGG + Intergenic
1176812033 21:13550843-13550865 GGTTTCCAGGTGTTTGAGGAGGG - Intergenic
1176992213 21:15510686-15510708 CATTTACAGGTGATTGTGGATGG - Intergenic
1177619822 21:23574511-23574533 GGTTGTCAGGAGCTTGTGGGAGG - Intergenic
1178412511 21:32377317-32377339 ACTTTTAAGGTGCTTATGCATGG - Intronic
1178598225 21:33973819-33973841 GCCTTTCAGGTGCTTTAAGAGGG + Intergenic
1178799708 21:35781126-35781148 GCTGCTCAGGTGCCTGAGGAAGG + Intronic
1179485130 21:41705203-41705225 GCTTTTGAGGTGGGTGTTGAAGG - Intergenic
1180234572 21:46450011-46450033 GCTTTTGAGGTGATTGTGGTGGG - Intergenic
1182194390 22:28500192-28500214 GGTTTTCAGGAGCTTGGGGTAGG - Intronic
1183408812 22:37643111-37643133 GCTTTTCTTGTGTTTGAGGATGG - Exonic
1184243838 22:43226009-43226031 GTTTATCACGTACTTGTGGAAGG - Intronic
1185168107 22:49274750-49274772 GCCTGGCAGGTGCTTGGGGAGGG - Intergenic
949589017 3:5473955-5473977 GTTTCTCAGGTGCATGTGCATGG + Intergenic
949604936 3:5642483-5642505 GTTATTCAGGTGGTTTTGGAAGG - Intergenic
949991587 3:9583625-9583647 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
950027297 3:9828983-9829005 GTTCTCCAGGTGCTTCTGGATGG - Exonic
950966745 3:17152051-17152073 GCCATTCAGGTGCTGGGGGAGGG + Intergenic
951092952 3:18597170-18597192 GCTTTTCTGGTGATAGTGAATGG - Intergenic
951281823 3:20760116-20760138 GCTTTTCAAGTGCTGGCAGAAGG + Intergenic
951678930 3:25274381-25274403 GCATGTGAGGTGCTTGTGAAGGG - Intronic
952542926 3:34386882-34386904 GCCTTTCAGGTTCTTTTTGAGGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952711141 3:36433111-36433133 TCCTTGCAGGTGCTTCTGGATGG - Intronic
955256133 3:57333440-57333462 GCTATTCAGGAGGTTGAGGAAGG - Intronic
955334625 3:58075134-58075156 GCTTTTCATGTGGTCGTGGTTGG + Intronic
956831547 3:73054026-73054048 GCTACTCAGGTGCTTGAGGCAGG - Intronic
957173937 3:76779510-76779532 GGTTGTCAGGTGCTTGGGGAGGG - Intronic
958514991 3:95102768-95102790 ATTTTTAAGGTGCTTGTTGAGGG + Intergenic
960735957 3:120781060-120781082 GCATTTCAGGAGCGTGAGGAAGG + Exonic
961368683 3:126416617-126416639 GCTTTTCAAGTGCTTCGGAAAGG + Intronic
961906742 3:130270731-130270753 AATGTTCAGGTGCCTGTGGAAGG + Intergenic
962914988 3:139893214-139893236 GCATTTCAGGTGGTGCTGGAGGG + Intergenic
963576127 3:147062649-147062671 GCTTTTTAGATTCTAGTGGAAGG + Intergenic
965959573 3:174412820-174412842 CCTTTTAAGGTGCATGTTGATGG - Intergenic
974648907 4:64729249-64729271 GCTTTTTAGTTTCTAGTGGAAGG + Intergenic
974881346 4:67761194-67761216 ACTTCTCAGGTGTTTTTGGATGG + Intergenic
974957731 4:68663772-68663794 GCTTTTAAGGTGTTTTTGGGGGG - Intronic
978383811 4:108160043-108160065 TCTCTTCAGATGCTTGGGGAGGG - Intronic
978765828 4:112403948-112403970 AGTTTACAGGTGCTTGGGGAGGG + Intronic
980298146 4:130950745-130950767 GCTTTGCATGTGTTTGAGGAGGG - Intergenic
980385407 4:132083545-132083567 GCTATTCAGGTAGTTGTGGTAGG + Intergenic
981367695 4:143922463-143922485 GGTTGTCAGGGGCTTGGGGAGGG - Intergenic
981498223 4:145417263-145417285 GCTATTCAGGAGACTGTGGAGGG + Intergenic
981974908 4:150714849-150714871 GCTTGTTAGGTGAATGTGGATGG - Intronic
983593626 4:169441712-169441734 GCTTTCCAGGGGCTTGGGAAAGG + Intronic
986525385 5:8668507-8668529 TCTTTTGAGATGCTTGTTGAAGG + Intergenic
986872736 5:12068969-12068991 GCTATTCAGGTGCCTGTGGTGGG + Intergenic
987229612 5:15880006-15880028 GGTTTTCAGATTCTTCTGGAGGG - Intronic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
992784692 5:80158233-80158255 GTGTTTCAGATGCTTGTGGTGGG - Intronic
993966800 5:94369044-94369066 GCTATTCAGGAGGTTGAGGAGGG + Intronic
994172214 5:96669975-96669997 GCTTCCCAGGTGCTTGTGACAGG + Intronic
994763188 5:103882838-103882860 ACTTTTGATGTGTTTGTGGATGG + Intergenic
994894291 5:105682310-105682332 TCTTTTCTTATGCTTGTGGAAGG - Intergenic
997521498 5:134526750-134526772 CCTTTCCAGGTGAGTGTGGAGGG + Intronic
997734096 5:136200804-136200826 GCTTTTGAGCTGCCTGTGGATGG + Intergenic
1001198978 5:169698846-169698868 GCATTTCAGGAGCGTGTGGCAGG + Intronic
1001327311 5:170738575-170738597 CCTTTTCAGGTGCCTGTGTCAGG + Intergenic
1001912992 5:175536418-175536440 GCTTGGCAGGTGATTTTGGAAGG - Intergenic
1002180529 5:177428879-177428901 GCTTTTCATGAGCTTGAGGCTGG + Intronic
1003302447 6:4896421-4896443 GCTCTGCAAGTACTTGTGGATGG + Intronic
1004305023 6:14492804-14492826 GCTTTTAAGGGGACTGTGGAAGG - Intergenic
1004710073 6:18161433-18161455 GCTTTGCAAGTGCTTCTGAAAGG + Exonic
1006468400 6:34210552-34210574 GCTATTCAGGAGCCTGTGGTGGG - Intergenic
1007395704 6:41576467-41576489 GCCTTGAAGGTGCTTGTGGTGGG + Intronic
1009811615 6:68675095-68675117 GCAGTTTAGTTGCTTGTGGATGG + Intronic
1011497396 6:87950089-87950111 GCTCTTGAGGTGCTTGGGGAAGG + Intergenic
1013751260 6:113409201-113409223 GCATTTCAGGAGCCTGAGGAAGG + Intergenic
1015473171 6:133629399-133629421 GCAGTTGAGGTGCTTGTTGAAGG + Intergenic
1018520826 6:164649355-164649377 GCTTTTCTGTTGCTTGTTTAGGG + Intergenic
1018949899 6:168372239-168372261 GCTGTTCAGGTGCCTTTGGGAGG + Intergenic
1018959763 6:168440372-168440394 GCATTTCAGGTGTTTGTGCGGGG - Intergenic
1021974216 7:25996178-25996200 GGTTTTCAGGTTCTTATTGATGG - Intergenic
1022455595 7:30555667-30555689 GGTTTTCAGGAGCTGGAGGAAGG - Intergenic
1022589021 7:31643335-31643357 GCTTTTCAGATGTTTGAGCAAGG - Exonic
1023905277 7:44517320-44517342 GTTTTTCAGGGGCTTGTGATAGG + Exonic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027707457 7:81552118-81552140 GCTTTTTAGTTTCTAGTGGAAGG + Intergenic
1032434873 7:131892048-131892070 GCTTTTCAGGTCCTTTTTGGAGG - Intergenic
1033286032 7:140041115-140041137 TCTTCGCAGGTGTTTGTGGATGG - Intronic
1033288041 7:140059435-140059457 GCTTATCAGACGCTTGTGGATGG - Intronic
1033328330 7:140398019-140398041 GCTTTTCAGGTAGGTGGGGAAGG - Intronic
1033865888 7:145689901-145689923 GCTTTTCAGATACTTCAGGAGGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035628964 8:1093938-1093960 TGTGTGCAGGTGCTTGTGGATGG + Intergenic
1036617901 8:10403169-10403191 GCTTCTCTGGTGCATTTGGAGGG - Intronic
1037510469 8:19577001-19577023 GCTTTTGAGGTGGGTGTGGAGGG - Intronic
1037693715 8:21205855-21205877 GTGTTCCAGGTGCTAGTGGATGG + Intergenic
1037787442 8:21911293-21911315 GCTTTTGAGGAGCTGGTGGAGGG - Intronic
1037789998 8:21930356-21930378 GCTATTCAGGTCCTTGAGCAAGG - Intronic
1037814565 8:22105111-22105133 GCTCTCCAGGTGGTTGTGCATGG + Intergenic
1039448064 8:37648427-37648449 TCTTTTCACGTGTCTGTGGAGGG - Intergenic
1042967173 8:74366247-74366269 GCTTTTAAGGTGTTTGTTTAGGG + Exonic
1047013146 8:120693751-120693773 GCTTTTCCGGTCTCTGTGGAAGG + Exonic
1052216539 9:25972823-25972845 ACCATTTAGGTGCTTGTGGAAGG + Intergenic
1052631567 9:31047827-31047849 TCTTGTGATGTGCTTGTGGAGGG + Intergenic
1052684210 9:31733715-31733737 GCTTTTGTGGAGGTTGTGGAGGG + Intergenic
1054796607 9:69307949-69307971 GCTTTTGTGTTTCTTGTGGAAGG - Intergenic
1055303384 9:74904691-74904713 GCTATTCAGGAGGTTGAGGAAGG - Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057584630 9:96318147-96318169 GCTTTTAAGAGGCTTCTGGAGGG - Intergenic
1057788435 9:98105843-98105865 GTTTTTCTGGTGCTAGTTGATGG - Intronic
1058022334 9:100102591-100102613 GCTATTCAGGTGGCTGAGGAGGG + Intronic
1059425676 9:114219613-114219635 TATGTTCAGGTGCTTGTCGATGG + Intronic
1059656601 9:116363218-116363240 GCCTTTCAAGTGCTTGATGAAGG - Intronic
1060100449 9:120836012-120836034 GGTTGCCAGGTGCTTGGGGAGGG - Intronic
1061858525 9:133456060-133456082 CCTTTTCAGGTGCCTGTGGCAGG + Exonic
1186089075 X:6024700-6024722 GCTGTCATGGTGCTTGTGGAAGG - Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1188002600 X:24996204-24996226 GGTCTTCAGGAGCTTGGGGAGGG - Exonic
1188448594 X:30284645-30284667 GACTTTCAGTTGCTTGAGGAGGG - Intergenic
1188875656 X:35427116-35427138 GTTTTGCAGCTGCTTGGGGATGG - Intergenic
1189952580 X:46247697-46247719 GGTGTTCAGGTGCTTTTGAAAGG - Intergenic
1194891690 X:99386378-99386400 GGTTTTCAGGGGCTGGGGGAAGG - Intergenic
1195924486 X:110012158-110012180 GCTTTTTAGTGGCTTGTGGATGG + Intronic
1197059203 X:122156533-122156555 GCTTTCCAGTAGCTGGTGGAAGG + Intergenic
1197314794 X:124952090-124952112 GCTTGTCAAGTGCTAGTGGTTGG - Intronic
1198012478 X:132572402-132572424 GCTTTCAAGGTACTTGTAGATGG - Intergenic
1199889459 X:152061196-152061218 GCTTTCCAGGTCCTGGTGGTAGG + Intergenic
1201595235 Y:15660761-15660783 GCTTTTAAGGGGATCGTGGAAGG + Intergenic
1201903475 Y:19066401-19066423 GCTACTCAGGTGCCTGAGGAAGG + Intergenic