ID: 1088903595

View in Genome Browser
Species Human (GRCh38)
Location 11:114137364-114137386
Sequence TTCCCAAGACACTTCCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088903595_1088903599 20 Left 1088903595 11:114137364-114137386 CCAAAATGGAAGTGTCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1088903599 11:114137407-114137429 AAAGATGAAAAGGCCACCAATGG 0: 1
1: 0
2: 0
3: 33
4: 384
1088903595_1088903597 -9 Left 1088903595 11:114137364-114137386 CCAAAATGGAAGTGTCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1088903597 11:114137378-114137400 TCTTGGGAAAGAAATGGAAGTGG 0: 1
1: 0
2: 3
3: 56
4: 603
1088903595_1088903598 10 Left 1088903595 11:114137364-114137386 CCAAAATGGAAGTGTCTTGGGAA 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1088903598 11:114137397-114137419 GTGGAAAGAGAAAGATGAAAAGG 0: 1
1: 0
2: 10
3: 134
4: 1262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088903595 Original CRISPR TTCCCAAGACACTTCCATTT TGG (reversed) Intronic
904887699 1:33753619-33753641 TTGCCATGACTCTACCATTTTGG - Intronic
907373212 1:54016211-54016233 CTCCCAATACACATCCATCTTGG - Intronic
908279062 1:62510644-62510666 TTCCAAAGGCACTTCCAGATGGG + Exonic
908955076 1:69615176-69615198 CTCCCTTGCCACTTCCATTTAGG + Intronic
909099441 1:71332332-71332354 TCCCCAAGACTCTTGCACTTTGG + Intergenic
909514353 1:76490389-76490411 CTCCTTAGACACTTCAATTTTGG + Intronic
911749589 1:101481148-101481170 TTCCCATGATACTTCCCTTAGGG - Intergenic
911942672 1:104068248-104068270 TGCCCAAGACCCTTCCCTTTAGG + Intergenic
912620176 1:111147911-111147933 TTCCCAATACCCTTGCATTAAGG - Exonic
915598295 1:156907670-156907692 TTTGGAAGACACCTCCATTTTGG - Exonic
916243917 1:162667786-162667808 TTCCCTAGACACTTCCCTTGAGG - Intronic
917098878 1:171426244-171426266 TTCCCAAGATTCTTCCCTTAGGG - Intergenic
921075385 1:211696585-211696607 TTTCCCAGACTCTTCCATATTGG + Intergenic
922737321 1:227994460-227994482 TTCCCAAGACCCTGCCTTGTGGG + Intergenic
1063765450 10:9135177-9135199 TTTCCAAGACACTCAAATTTAGG + Intergenic
1064123876 10:12642488-12642510 ATCCCAAGAAATTTCCTTTTGGG - Intronic
1065763158 10:29002059-29002081 TTCCGCACACACTTCAATTTAGG + Intergenic
1067990212 10:51203508-51203530 TTGCCTAGAAAATTCCATTTGGG - Intronic
1068027308 10:51662598-51662620 TTCCCAACTCACTTTCTTTTTGG + Intronic
1068173382 10:53424522-53424544 TTTCCAGGACAATTACATTTTGG - Intergenic
1068309360 10:55258341-55258363 TTCCCATGATTCTTCCATTAGGG - Intronic
1068789967 10:61017580-61017602 TTCCCAATGCACTTGCAGTTAGG - Intergenic
1069276186 10:66594038-66594060 TCCACCTGACACTTCCATTTGGG + Intronic
1070933545 10:80277009-80277031 TGACCAAGACATTTACATTTTGG - Intronic
1071230912 10:83584384-83584406 TTCCCAATATACTTTAATTTTGG + Intergenic
1072556514 10:96519202-96519224 TTCACAAGTCATATCCATTTTGG - Exonic
1072848941 10:98865258-98865280 TTCCTAAGATACTTCCAAATTGG + Intronic
1072898170 10:99385169-99385191 TTCCCAAGAGACTTCCAGCCTGG + Intronic
1073888783 10:108072601-108072623 TTCCCATGATTCTTCCATTAGGG + Intergenic
1074018560 10:109560827-109560849 TTCCCAACACTTTTGCATTTGGG + Intergenic
1074384567 10:113006735-113006757 ATGCCAACACATTTCCATTTGGG - Intronic
1075325208 10:121526162-121526184 TTGCTAAGAGACTGCCATTTTGG - Intronic
1076778249 10:132709888-132709910 TTCCCAAGGGTCTTCCCTTTGGG + Intronic
1077777466 11:5287395-5287417 TTGCCACTACACTCCCATTTGGG + Intronic
1078706285 11:13747108-13747130 TTCACAAGACACTTTTCTTTTGG + Intergenic
1078892533 11:15570290-15570312 CTCCCAACACAGTTGCATTTGGG - Intergenic
1079633770 11:22710781-22710803 TTCTCCTGACACTTCCATCTTGG - Intronic
1080356278 11:31450501-31450523 TTCCTAAGTGACTTCTATTTAGG - Intronic
1080962936 11:37181367-37181389 TTCCCATGATTCTTCCCTTTGGG - Intergenic
1081055902 11:38411012-38411034 ATTCCAAGCCAGTTCCATTTTGG + Intergenic
1082946172 11:58763311-58763333 TTCCCTGCACACTTCCAGTTAGG + Intergenic
1085490799 11:76915296-76915318 TTCCCATGATACTTCCCTTAGGG + Intronic
1086952014 11:92900114-92900136 TTCTCAAAATCCTTCCATTTTGG + Intergenic
1088174881 11:107041088-107041110 TTCCCACAACATTTCCACTTAGG + Intergenic
1088567271 11:111185224-111185246 TTCCCAAGACACTCTACTTTTGG - Intergenic
1088903595 11:114137364-114137386 TTCCCAAGACACTTCCATTTTGG - Intronic
1090714275 11:129416344-129416366 TTCTCAACACACTAACATTTTGG - Intronic
1091130528 11:133143269-133143291 TTCACAACTCCCTTCCATTTTGG + Intronic
1092858853 12:12701313-12701335 TTCCCAGCACACTAACATTTTGG - Intergenic
1096120813 12:49088551-49088573 CACCCAAGACACTTCCCTTCTGG + Intergenic
1098584714 12:72142184-72142206 TTCCCATGACTCTTCCTTTATGG - Intronic
1098647295 12:72919412-72919434 TTCCTAAGACACTTGCAGTATGG + Intergenic
1099849197 12:88070729-88070751 TTCCCTAGGGATTTCCATTTGGG - Intronic
1101805898 12:108063518-108063540 TTCCCACCACTGTTCCATTTGGG + Intergenic
1103287003 12:119810833-119810855 TTCCCATGAGACTTCGATATGGG - Intronic
1104895787 12:132163038-132163060 TTCCCCAAACCCTCCCATTTGGG + Intergenic
1108011818 13:46022890-46022912 TTCCTAAGACACAGACATTTGGG - Intronic
1109680273 13:65742711-65742733 TTTCCAATATAATTCCATTTTGG + Intergenic
1111287860 13:86119120-86119142 CTCCCCAGACACTCCCAGTTGGG + Intergenic
1111966693 13:94868730-94868752 TTCCAAATACACTTACATTAGGG - Intergenic
1112110495 13:96291757-96291779 TTCCCAAATCAATTACATTTTGG - Intronic
1112259608 13:97866429-97866451 TTCACCAGACAGTTCCAATTTGG - Intergenic
1113312807 13:109148697-109148719 TTCCCACGTCACTGACATTTTGG - Intronic
1114264783 14:21067217-21067239 TTCCGAAGACATTTCCAGTATGG - Intronic
1114339355 14:21727044-21727066 TTCCCACGACACTCAAATTTGGG - Intergenic
1116145518 14:41063165-41063187 TTCTCAAGAAACTTACAATTTGG + Intergenic
1117782030 14:59243168-59243190 TTCCCTAGCCACTTACCTTTTGG - Intronic
1123824683 15:24069233-24069255 TTCCCATGATTCTTCCATTAGGG + Intergenic
1124349056 15:28942414-28942436 TTCCCAACACAGTTCCTTATGGG - Intronic
1126069124 15:44850339-44850361 TTCCCAAGAACTTACCATTTGGG + Intergenic
1126089687 15:45040434-45040456 TTCCCAAGAACTTACCATTTGGG - Exonic
1126868978 15:52967417-52967439 TCCCCCAGTCACTTCCAGTTGGG + Intergenic
1127659871 15:61090381-61090403 TTGCCAACACACTGTCATTTGGG + Intronic
1130262533 15:82368571-82368593 TGCCCAAGACAATTCAATTGGGG - Intergenic
1130278697 15:82500376-82500398 TGCCCAAGACAATTCAATTGGGG + Intergenic
1131444521 15:92486252-92486274 TTTCCAACCCACTTCCAGTTAGG + Intronic
1134111407 16:11517588-11517610 GTCTCAAGTCACTTCCAGTTCGG - Intronic
1135128611 16:19833241-19833263 TTCCTAAGAAACTTCTATGTTGG - Intronic
1135161683 16:20102163-20102185 TCCTCCAGACACATCCATTTTGG - Intergenic
1135281452 16:21156942-21156964 TTCCAAAGCAACTTCCATTTAGG + Intronic
1138208069 16:55139544-55139566 TCCCCCAGAAACTTCCACTTAGG - Intergenic
1140348188 16:74235167-74235189 TTCCCTAGACATTTACATGTAGG - Intergenic
1140998557 16:80285758-80285780 GTCCCAAGTCACTGTCATTTGGG + Intergenic
1141104661 16:81223582-81223604 TCCCCAAGCAACTTCCATTAGGG - Intergenic
1147358208 17:39913885-39913907 TTCCAAAGACAAATCCATTTTGG + Intronic
1149558967 17:57594524-57594546 TCCCCAAGCCACTTCTCTTTGGG - Intronic
1154260895 18:12831755-12831777 TGCCCAATACTCTTCCATTGAGG - Intronic
1155600640 18:27542675-27542697 TTCCCAAGTAACATACATTTGGG - Intergenic
1157686406 18:49646095-49646117 GTCCCAGGGCACTTTCATTTTGG + Intergenic
1158444273 18:57505255-57505277 TTCCCAATCCAACTCCATTTTGG + Intergenic
1158907335 18:62026736-62026758 TTCCCAAGACAAATTCATTCTGG - Intergenic
1159049661 18:63408325-63408347 TAACCAAGGCAATTCCATTTTGG - Intronic
1159477935 18:68948477-68948499 TTCCAAATACACTTCAATTTTGG - Intronic
1164717214 19:30401524-30401546 TTCCCCAGACACTACTGTTTTGG + Intronic
1166148466 19:40853004-40853026 TTCCCAAGACACTGCCCACTGGG - Intronic
1166152607 19:40884789-40884811 TTCCCAAGACACTGCCCACTGGG - Intronic
1168505612 19:56932055-56932077 TTCCTAGGATACTTCCTTTTTGG + Intergenic
1168550683 19:57290791-57290813 GTCCCAAGATACTCCTATTTGGG + Exonic
925013683 2:505394-505416 GTGCCACGACACTTCCAATTAGG - Intergenic
928013689 2:27634534-27634556 TTCCCAAGAGATTTACATTCTGG + Intronic
928287781 2:30008526-30008548 TCCCCAACACACTTCCATACAGG - Intergenic
928534649 2:32228251-32228273 TTCCCAGAACACTTGCAATTGGG + Intronic
935316907 2:101843850-101843872 TTGACAAGACATTTCTATTTAGG - Intronic
937556212 2:123160421-123160443 TTCCCAACACACTTCCAGGAAGG - Intergenic
938177851 2:129152785-129152807 TGCCCAAGGCCCTTCCCTTTAGG + Intergenic
939995882 2:148919114-148919136 TCCTCTAGACATTTCCATTTAGG - Intronic
940229174 2:151431834-151431856 AGTCCAAGACACTTCCTTTTTGG - Intronic
941541828 2:166795557-166795579 ATCCCTAGACACTTCTACTTGGG - Intergenic
942390958 2:175492550-175492572 TTCCCCAGACACCTCCCATTAGG + Intergenic
942963564 2:181862020-181862042 TTTGCAAGACAATTTCATTTCGG - Intergenic
944479407 2:200140639-200140661 TTTCCAACACACTTCTGTTTTGG - Intergenic
944491161 2:200259095-200259117 TTCCAAAGAGGCTTCCAGTTGGG + Intergenic
945169394 2:206980054-206980076 TTCCCAAATCACTTTCATTAGGG + Intergenic
946829129 2:223710132-223710154 TTCCTAATGGACTTCCATTTTGG + Intergenic
947705055 2:232267922-232267944 TTCCCAAGACACTTTCATAATGG - Intronic
1168778266 20:466390-466412 TTTGAAAGACACTTTCATTTGGG + Intergenic
1169823999 20:9746152-9746174 CTTCCCAGACACTTCCCTTTTGG + Intronic
1171368450 20:24644132-24644154 TTCCAAACACACTTTGATTTAGG + Intronic
1172978023 20:38920774-38920796 TTCCCACGACCTTGCCATTTGGG + Exonic
1173158403 20:40634107-40634129 TTCTCAATACACCCCCATTTGGG + Intergenic
1178890987 21:36521017-36521039 TCCCCAAGCCACTGCCATTTTGG - Intronic
1179822976 21:43947507-43947529 GTCCAAAGTCACTTCCATCTCGG + Intronic
1183428693 22:37752829-37752851 TTCCCAGGGCCCTTCCAGTTCGG - Intronic
1184103114 22:42351954-42351976 TCCCCAAGTCACTTTGATTTTGG - Intergenic
1184180278 22:42818138-42818160 TACCCAAATCACTTCCATATGGG + Intronic
1185180643 22:49359142-49359164 CTCCCAAGGCACTTTCATTCGGG + Intergenic
949905437 3:8854774-8854796 TTCCCAATATGCTTCCATTTAGG - Intronic
951093186 3:18598780-18598802 TTCCAAAGTCACTTTCATATTGG + Intergenic
951706359 3:25547667-25547689 TTACCAAGACACTGCCAACTTGG - Intronic
951801154 3:26597229-26597251 TTCCCAAGCCAATTGCATTAGGG - Intergenic
953033956 3:39195635-39195657 TTCCCAAGCCACTTCTGGTTTGG - Intergenic
953106137 3:39881508-39881530 TTCCCAAGATAGTGGCATTTAGG - Intronic
953370160 3:42380781-42380803 TTCCCACCACACTTCCATGGGGG + Intergenic
953948868 3:47172410-47172432 TCCCCAAGACTTTACCATTTTGG - Intergenic
955528618 3:59848604-59848626 TTCCCAAAGTACTTACATTTAGG + Intronic
956614647 3:71158464-71158486 TGACAAAGACACTGCCATTTAGG + Intronic
959664805 3:108909176-108909198 TTCGTAAGACACCTCCCTTTTGG + Intronic
960246020 3:115401149-115401171 TTCCCAAGATTCTTCCCTTAGGG - Intergenic
960981912 3:123237425-123237447 CCTCCAAGACACATCCATTTTGG + Intronic
963678302 3:148342488-148342510 TTCCCAAGGTAATTCCAATTAGG - Intergenic
963952423 3:151217542-151217564 TTCCCCAAACACTGCTATTTTGG + Intronic
965299398 3:166990779-166990801 TTCCCATGATTCTTCCCTTTGGG - Intergenic
965639485 3:170817575-170817597 TTCCCAAATGACTTCCCTTTTGG + Intronic
965640455 3:170824021-170824043 TTCCCAAATGACTTCCCTTTTGG + Intronic
965812631 3:172607411-172607433 TTCCCATTGCACTTCCTTTTTGG - Intergenic
966584513 3:181606623-181606645 TTCCTAAGAAACTCTCATTTCGG - Intergenic
966646051 3:182247424-182247446 TTCCCAAGAGAGTTTTATTTTGG + Intergenic
967553789 3:190831362-190831384 GTCCCAAGACAATGCCCTTTTGG - Intergenic
967938055 3:194745175-194745197 TTGCTAAGAGACTTCCCTTTTGG + Intergenic
970300585 4:14677793-14677815 CTCTTAAGATACTTCCATTTTGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
973834306 4:54793806-54793828 TTGCCAAAACACATCCATTGAGG + Intergenic
975125634 4:70779329-70779351 TTTACAATACACTTCCTTTTCGG + Intronic
978376451 4:108079238-108079260 TTCTGAAGATTCTTCCATTTTGG + Intronic
978572697 4:110156335-110156357 TTTCCAAGACATTTCCACATTGG + Intronic
980820530 4:138010208-138010230 GTTCCAAGACAATTCCAATTTGG - Intergenic
980886915 4:138772798-138772820 TTCCCAGGACACTTCTATGTTGG - Intergenic
982422805 4:155217472-155217494 TTCCCAAAAGCCTTACATTTTGG + Intergenic
982527505 4:156497888-156497910 TTCCCAATACTGTTACATTTGGG + Intergenic
983289577 4:165784995-165785017 TTCCCAAGACACTACCCATCTGG - Intergenic
986650479 5:9958840-9958862 TTCCCATGATTCTTCCCTTTAGG + Intergenic
987866645 5:23549329-23549351 TTCCTATGACACTTGCCTTTTGG + Intergenic
992041375 5:72836509-72836531 TTCCCAAGGCACTGACATTCTGG + Intronic
992980980 5:82171622-82171644 ATCCAAACACACTTCCAATTTGG - Intronic
993817675 5:92572374-92572396 TTCCAAAGACAGGCCCATTTTGG - Intergenic
993952560 5:94194435-94194457 TTCCAAAGAGACTACTATTTGGG - Intronic
994339811 5:98613258-98613280 CTCCAAAGAGACTTCCTTTTTGG + Intergenic
994582736 5:101666909-101666931 TTCCCAAGGCACTTCAGTTCAGG + Intergenic
994842891 5:104949508-104949530 TTCCCAAGAAACTTATACTTGGG - Intergenic
996050174 5:118923544-118923566 TTCCCAAGATTCTTCCGTTAGGG - Intronic
996870810 5:128191142-128191164 TTACCAATACACTATCATTTTGG - Intergenic
997587028 5:135049284-135049306 TTCCCCAGCCACCTTCATTTAGG + Intronic
999776534 5:154816613-154816635 TTCTGAAGACACTTGAATTTAGG + Exonic
1004594495 6:17086283-17086305 TTCCCACTACACTCCCTTTTGGG + Intergenic
1004681676 6:17901660-17901682 GTCCCAAACCCCTTCCATTTTGG + Intronic
1005106441 6:22229191-22229213 TTCCCATGACTCTTCCCTTAGGG + Intergenic
1005156984 6:22818802-22818824 TGCCCAAGGCCCTTCCCTTTAGG + Intergenic
1005471665 6:26167120-26167142 TTCTGAAGACACTTGAATTTAGG + Intronic
1006413694 6:33891107-33891129 TTCCAAGCACACTCCCATTTGGG + Intergenic
1007460861 6:42017669-42017691 TTCCATAGACACTTCTGTTTTGG - Intronic
1008067864 6:47069663-47069685 TTTCCAAAACACTTCTTTTTGGG - Intergenic
1009303339 6:62055501-62055523 TTGACAAGACACTGCCATTATGG - Intronic
1009930927 6:70176785-70176807 TTCCCAAGTCACTTTCATGGAGG + Intronic
1011074128 6:83419943-83419965 TTCACATGATACTTCCACTTAGG - Intronic
1012282091 6:97339967-97339989 TGACTAAGACACTTCCTTTTAGG + Intergenic
1012916567 6:105177597-105177619 TTCCTAAAACAGATCCATTTAGG + Intronic
1015207583 6:130657373-130657395 TTCCCAACACATTTCTATTTTGG + Intergenic
1015797023 6:137023288-137023310 TTCCAAAGACACTGTCCTTTTGG - Intronic
1017924726 6:158901187-158901209 TTCCCAAGACCCTTCCCTTCAGG + Intronic
1018491456 6:164298029-164298051 TTCCCAAACCTCCTCCATTTAGG - Intergenic
1023173134 7:37409435-37409457 TTCTCATGAAACTACCATTTGGG + Intronic
1027976021 7:85156967-85156989 ATGCAAACACACTTCCATTTGGG - Intronic
1027976949 7:85170729-85170751 TTCCCAAGACACTAACTCTTGGG + Intronic
1030257722 7:107529613-107529635 TTCCCAAGATTCTTCCCTTAGGG - Intronic
1031019995 7:116617151-116617173 TTCCCAAGAAATTTTTATTTTGG - Intergenic
1037254912 8:16942333-16942355 TTCCCAAGGCCCTTCCCTTCAGG - Intergenic
1037291094 8:17350142-17350164 ATCCCAGGACACTTCCATGTGGG - Intronic
1038223309 8:25631294-25631316 TTTCTCAGACACTTCCCTTTAGG - Intergenic
1038253971 8:25933437-25933459 TGCCCTAAAGACTTCCATTTTGG + Intronic
1038338824 8:26667089-26667111 TTCCCAAGCCATTTGCATGTAGG - Intergenic
1041519633 8:58740982-58741004 CTGCAAACACACTTCCATTTTGG + Intergenic
1043711200 8:83421112-83421134 TTCTCAAAACACTTAAATTTGGG - Intergenic
1044756101 8:95462685-95462707 TTCCAAAGACTCATCCATTTTGG + Intergenic
1045269545 8:100650069-100650091 AACCCAAGCCATTTCCATTTGGG - Intronic
1045829668 8:106443748-106443770 TTTCCAAGGCAATTCCATTCAGG + Intronic
1047429989 8:124782748-124782770 TTCCCCAGACAGGGCCATTTAGG - Intergenic
1048935812 8:139355845-139355867 TTCCTAAGACTCTACCCTTTTGG + Intergenic
1048958988 8:139560115-139560137 TTCACAAGATACTACCATTGGGG - Intergenic
1055253626 9:74338852-74338874 TTCCCATGACTCTTCCCTTAGGG + Intergenic
1056309303 9:85322946-85322968 TTCCCAGGATACTTCCCTTAGGG - Intergenic
1057418700 9:94889703-94889725 TACCCAAGACAGTTCAATTGTGG + Intronic
1057571280 9:96206013-96206035 TTACCAGGACATTTCCAGTTTGG + Intergenic
1057967179 9:99515573-99515595 ATCCCAGGACACTGACATTTTGG + Intergenic
1059043319 9:110838347-110838369 TTCCCAAGACAGTGCCTTTCTGG - Intergenic
1061243011 9:129385172-129385194 TTCCCAGGACACTCCCTTTTGGG - Intergenic
1187038796 X:15570855-15570877 TTCCCTAGAGACTTCCCTCTTGG - Intronic
1188379054 X:29468928-29468950 TTACAAAGATGCTTCCATTTAGG - Intronic
1191968364 X:66786083-66786105 TTCCAATGACAATTCAATTTGGG - Intergenic
1192024403 X:67433452-67433474 TTCTCAACTCACTTCCACTTGGG + Intergenic
1193974419 X:88099728-88099750 TTCCCATGACTCTTTCATTAGGG + Intergenic
1194445168 X:93978303-93978325 TTCCCTAGACATTTCCATTTTGG + Intergenic
1195199448 X:102533368-102533390 TTCCCAAGGCCCTTCCTTTTAGG - Intergenic
1195579180 X:106482268-106482290 TTGCCCAGACACCTCCATCTTGG - Intergenic
1196199730 X:112871982-112872004 TTCCCAAGTGACTTTAATTTGGG + Intergenic
1196532460 X:116805586-116805608 TGCCCAAGGCCCTTCCTTTTAGG + Intergenic
1196795080 X:119495832-119495854 TTCCCAAGCCAGTGCCTTTTAGG + Intergenic
1197354959 X:125427457-125427479 TTCTTGTGACACTTCCATTTTGG - Intergenic
1198331367 X:135626049-135626071 TTGCTAAGACCCTTCCATTTAGG + Intergenic
1201357217 Y:13110445-13110467 TACACAATACAATTCCATTTAGG + Intergenic