ID: 1088907023

View in Genome Browser
Species Human (GRCh38)
Location 11:114162704-114162726
Sequence ACCAAAGGCGCCCCCACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 49}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088907023_1088907034 24 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907034 11:114162751-114162773 ATCAGATGGGGGTGGCTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 208
1088907023_1088907032 13 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907032 11:114162740-114162762 AAGTGGAGAAGATCAGATGGGGG 0: 1
1: 0
2: 0
3: 24
4: 307
1088907023_1088907028 -4 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907028 11:114162723-114162745 TGGTTTTTGGGTCAAGGAAGTGG 0: 1
1: 1
2: 1
3: 44
4: 422
1088907023_1088907026 -10 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907026 11:114162717-114162739 CGCCTTTGGTTTTTGGGTCAAGG 0: 1
1: 0
2: 3
3: 12
4: 138
1088907023_1088907029 10 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907029 11:114162737-114162759 AGGAAGTGGAGAAGATCAGATGG 0: 1
1: 0
2: 2
3: 57
4: 576
1088907023_1088907033 16 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907033 11:114162743-114162765 TGGAGAAGATCAGATGGGGGTGG 0: 1
1: 0
2: 1
3: 52
4: 408
1088907023_1088907035 29 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907035 11:114162756-114162778 ATGGGGGTGGCTCAGAGGCCAGG 0: 1
1: 0
2: 1
3: 35
4: 343
1088907023_1088907031 12 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907031 11:114162739-114162761 GAAGTGGAGAAGATCAGATGGGG 0: 1
1: 0
2: 2
3: 29
4: 351
1088907023_1088907030 11 Left 1088907023 11:114162704-114162726 CCTTATGTGGGGGCGCCTTTGGT 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1088907030 11:114162738-114162760 GGAAGTGGAGAAGATCAGATGGG 0: 1
1: 0
2: 0
3: 29
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088907023 Original CRISPR ACCAAAGGCGCCCCCACATA AGG (reversed) Intronic
900143442 1:1147907-1147929 ACCACAGGCGCCGCCACACGTGG - Intergenic
904756752 1:32772233-32772255 ACCTAAGGCTCCCCCACCTGTGG + Exonic
905268586 1:36771782-36771804 GCCAGAGGCGCCACCACACAGGG - Intergenic
907332452 1:53679953-53679975 ACCCAGGGTGCCCCCAAATATGG + Intronic
917176596 1:172242579-172242601 ATCATAGGCGCCACCACATGTGG + Intronic
922019349 1:221688122-221688144 ACCCAAGGCGCCGGCACAGATGG - Intergenic
1068526651 10:58138146-58138168 ACCCAAGGCAACCCCACAAAGGG + Intergenic
1069294762 10:66830002-66830024 ACCACAGGCGCCCTCCCACAGGG + Intronic
1077317342 11:1925387-1925409 AGCCAAGGGGCCCCCACATGTGG + Intronic
1077774054 11:5252189-5252211 TCCAAAGCCTCCCCCACAAATGG + Intronic
1083307821 11:61770093-61770115 ACCAACGGCCCTCCCACCTAGGG + Intronic
1088907023 11:114162704-114162726 ACCAAAGGCGCCCCCACATAAGG - Intronic
1090414541 11:126531558-126531580 ACCCAAGGCTCCCCCACCCAAGG + Intronic
1091423602 12:365608-365630 ACCAACGGTGCACCCACAAAGGG + Intronic
1092044107 12:5415002-5415024 TCCAAGGGCCCCCCCTCATAAGG + Intergenic
1103502875 12:121417962-121417984 ACTAAAGGCCCCACCATATACGG - Intronic
1105960947 13:25338668-25338690 ACCACAGGGGCCTCCACATTTGG + Exonic
1108123069 13:47210647-47210669 ACTAAAGGAGCCCCCAGCTAAGG - Intergenic
1108578770 13:51811250-51811272 ACCAAGGCGGCCCCCACAAAAGG + Intergenic
1113975916 13:114227119-114227141 ACCATAGGCACCACCACATCCGG - Intergenic
1129411171 15:75351117-75351139 ACCAATGGCAAACCCACATATGG + Intronic
1138360356 16:56423082-56423104 GACAAAGGCACCACCACATAGGG + Intronic
1146559618 17:33856981-33857003 ACCCAAGGGGACCCCACCTAAGG + Intronic
1162216281 19:9136697-9136719 ACCAAAGGCGTCTCCACAGGTGG + Intergenic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
925292814 2:2759022-2759044 ACCAAAGGGGCTCCCACGCATGG + Intergenic
925408362 2:3624240-3624262 CCCAAAGGCACCCCCACAGATGG - Intronic
926705446 2:15834329-15834351 CCCAAATGCGGCCCCACAAAAGG - Intergenic
937503136 2:122505226-122505248 ACCACAGGCTCCCCACCATAAGG - Intergenic
940704424 2:157086079-157086101 ACAAAAGCCTCCCCCACACAAGG + Intergenic
946580045 2:221118507-221118529 CCCAAAGGCCCCATCACATAGGG + Intergenic
948171106 2:235903953-235903975 TCCAAAGGCAGCCCCACAGAAGG + Intronic
949011407 2:241681228-241681250 ATCACAGGGGCACCCACATAAGG + Intronic
1169364376 20:4979379-4979401 ACCAAAAGCGCCCAAACTTAAGG + Intronic
1170518898 20:17162635-17162657 ACCAGAGGTGCCCCCACTTCTGG + Intergenic
1178019537 21:28393748-28393770 ACCAAAGGCTCACCCACCTTGGG - Intergenic
1181746688 22:24959993-24960015 ACCACAGGCGCCACCACACCTGG - Intronic
1183858681 22:40653452-40653474 GCCAAGGGCCCCTCCACATAAGG + Intergenic
950350842 3:12350498-12350520 TTCAAAGACGCCCCCACACAGGG - Intronic
963000643 3:140678585-140678607 ACCCAATGCGGCCCCACATCTGG - Intronic
968333735 3:197894919-197894941 ACCACAGGCGCCACCACACCTGG - Intronic
976932046 4:90578727-90578749 AACAATGGCCCCCCCAAATATGG - Intronic
990810036 5:59713601-59713623 ACCAAAGGCTCGCCCACCTTGGG - Intronic
994448075 5:99903267-99903289 ACGTAAGCTGCCCCCACATATGG - Intergenic
1007096887 6:39218772-39218794 GCCAAAGGTGCCCCCAGCTAGGG + Intronic
1019611531 7:1939257-1939279 ACCAGAGGCGCGCGCACACATGG + Intronic
1022122356 7:27321729-27321751 ACCAAAAGGGCCCACCCATACGG - Intergenic
1042962561 8:74320325-74320347 TCCAAATGCACCCCCAAATAAGG + Intronic
1057791994 9:98130714-98130736 ACCAATGGTCCCCCCACATCTGG + Intronic
1062327578 9:136019597-136019619 AACAACCGCGCCCCCACACAGGG + Intronic
1062503164 9:136859836-136859858 TCCAAAGCAGCCCCCACATCTGG - Intronic
1195936732 X:110132833-110132855 ACCATAGGAGCTACCACATAAGG + Intronic