ID: 1088913273

View in Genome Browser
Species Human (GRCh38)
Location 11:114208123-114208145
Sequence CTATGGTGCTGGAGACCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088913273_1088913279 23 Left 1088913273 11:114208123-114208145 CCTTCTGGTCTCCAGCACCATAG 0: 1
1: 0
2: 0
3: 9
4: 199
Right 1088913279 11:114208169-114208191 ATCTTGCCACTGCACGAGTTAGG 0: 1
1: 0
2: 1
3: 8
4: 105
1088913273_1088913280 24 Left 1088913273 11:114208123-114208145 CCTTCTGGTCTCCAGCACCATAG 0: 1
1: 0
2: 0
3: 9
4: 199
Right 1088913280 11:114208170-114208192 TCTTGCCACTGCACGAGTTAGGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088913273 Original CRISPR CTATGGTGCTGGAGACCAGA AGG (reversed) Intronic
900236641 1:1594749-1594771 CCATGGAGCTGGAGCGCAGATGG - Intergenic
901738593 1:11327863-11327885 CTAGGGTCCTGGAGAGCAGGAGG + Intergenic
901929809 1:12589947-12589969 AGATGGAGGTGGAGACCAGATGG - Intronic
902070982 1:13737415-13737437 CAGTGGTGATGGAGACCATATGG + Intronic
902402674 1:16166676-16166698 CTATGGTGCAACAGACCACAGGG - Intergenic
903915962 1:26764506-26764528 CTCTGGTGCTAGAGTACAGAAGG + Intronic
905942503 1:41875164-41875186 GGATGGTGCTGGAGCCCTGAAGG - Intronic
907328767 1:53657980-53658002 CAAGGTTGCTGGAGACCAGGTGG - Intronic
913689135 1:121261680-121261702 CCTTGGAGCTGGAGACCAGCTGG - Intronic
914148463 1:145018601-145018623 CCTTGGAGCTGGAGACCAGCTGG + Intronic
915905411 1:159873284-159873306 AAATGGGGCTGGAGCCCAGAGGG - Intronic
916475282 1:165162987-165163009 CTCTGGTGCCGGAGGCCAGGAGG - Intergenic
918209616 1:182339414-182339436 CTATGGTACTAGGGGCCAGAAGG - Intergenic
918222116 1:182444604-182444626 CTCTGGTCCTGGGGACCAGTGGG + Intergenic
919754085 1:201055820-201055842 CTTTGGTGGTGGAGGCCAGGAGG - Intronic
919896538 1:202012811-202012833 TTATGGTGCTGGGAGCCAGAGGG - Intronic
920393229 1:205624441-205624463 TTATGGTGATGGAAACCAGTTGG - Intronic
920415157 1:205794714-205794736 CAAGGGTGCAGGAGAACAGATGG - Intronic
920476458 1:206280155-206280177 CCTTGGAGCTGGAGACCAGCTGG - Intronic
920556933 1:206910673-206910695 CTAAGGTGCTGAACACCGGAAGG - Intronic
923034987 1:230279478-230279500 CAATGGTGCAGGAGACAGGACGG - Exonic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
1062907289 10:1187430-1187452 TGATGGTCATGGAGACCAGAAGG - Intronic
1062909682 10:1204700-1204722 CGATGGTGCTGGACACAGGAGGG - Intronic
1063875278 10:10470130-10470152 CTAAAATGCTTGAGACCAGAAGG - Intergenic
1069426160 10:68290358-68290380 CTAAGGCTCTGGAGAACAGATGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071495488 10:86164910-86164932 CTTGGGTGATGGGGACCAGAAGG + Intronic
1074551330 10:114445079-114445101 CATTGGTGCTGGAGGTCAGAGGG - Intronic
1075160559 10:120021065-120021087 TGATGTTGCTGGTGACCAGAGGG + Intergenic
1077137235 11:1006766-1006788 CTATGGTGCTGGGCAGGAGAAGG + Intronic
1077139178 11:1016062-1016084 CAATGGTGCTGGAGGCTAGGTGG + Exonic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077269354 11:1667779-1667801 CTGTGGTGGTGCAGCCCAGAAGG + Intergenic
1078878722 11:15425902-15425924 CTAGGACACTGGAGACCAGAGGG - Intergenic
1079747780 11:24155171-24155193 ATGTGGTTCTGTAGACCAGAGGG - Intergenic
1079747811 11:24155346-24155368 CTATGGTGCTGAGAAGCAGATGG + Intergenic
1080411872 11:32032732-32032754 CGCTGCTGCTGGAGAGCAGAAGG - Intronic
1081976888 11:47241092-47241114 AGATGGGGCAGGAGACCAGATGG + Intronic
1082275064 11:50212454-50212476 ATATGAGGCTGGAAACCAGATGG + Intergenic
1085968211 11:81554835-81554857 CTATAGTGCTGGAGTGCAGTAGG - Intergenic
1086925042 11:92631074-92631096 GTTTGGTGCTGAAGACCTGAAGG - Intronic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1088154798 11:106790258-106790280 CTATGGTGGTGGTGGCCACAGGG - Intronic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1090059157 11:123448815-123448837 CTATGGTGATGGAGCTGAGAAGG - Intergenic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1092925777 12:13270812-13270834 CTCTGGTACTTAAGACCAGATGG - Intergenic
1094745445 12:33339244-33339266 CACAGGTGCTGGAGAACAGATGG + Intergenic
1096612485 12:52811933-52811955 ATAAGGTCCTGGAGACCAAATGG - Exonic
1096615609 12:52831582-52831604 ATAAGGTGCTGGAGACCAAGTGG - Exonic
1097076156 12:56396361-56396383 CTCAGGAGCTCGAGACCAGACGG + Intergenic
1102655737 12:114480943-114480965 CTCAGGTCCTGGAGTCCAGAAGG - Intergenic
1102983260 12:117259055-117259077 CAAAGGTGCTGGTGACCACAAGG + Exonic
1103499734 12:121392079-121392101 CTCTGCAGCTGGAGAACAGATGG - Intronic
1103508021 12:121454457-121454479 CTCTGGGGCTGGGAACCAGAGGG - Intronic
1108446111 13:50510608-50510630 TTATGGGGCTGGAGTTCAGAAGG + Intronic
1109842458 13:67937270-67937292 CTCAGGAGCTGGAGACCAGCTGG + Intergenic
1110400386 13:75083155-75083177 TTCTGGTCCTGGAGGCCAGATGG + Intergenic
1110915133 13:81011932-81011954 CTGTGGTGTTGGTTACCAGAAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1121452307 14:94016763-94016785 TCATGGTGCTGGAGAGCAGGTGG - Intergenic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1124560475 15:30769537-30769559 TCATGCTGCTGGAGACCAGCCGG + Intronic
1127653078 15:61028315-61028337 CTATTGTGCTGGAGATAGGAAGG - Intronic
1129002599 15:72346807-72346829 CTTTGCTGCTGGGGAACAGAGGG - Intronic
1131807474 15:96137552-96137574 CTATTGTGCTGGAGTGCAGGAGG + Intergenic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1132749753 16:1452096-1452118 CTGTGCTGCTGGAGCCCAGGAGG - Intronic
1133659905 16:7906186-7906208 CTATCAGCCTGGAGACCAGAGGG - Intergenic
1133929828 16:10223065-10223087 CTATTCTGCAGGAGAACAGATGG + Intergenic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1137934052 16:52616967-52616989 CAGTGGTGCTGGAGAACATATGG - Intergenic
1138569660 16:57861616-57861638 CCATGGTACTGGGGGCCAGAAGG + Intronic
1141964790 16:87434599-87434621 CGGTGGTGCAGGAGACCAGGCGG - Intronic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1143058593 17:4180930-4180952 CTATGGCTGGGGAGACCAGATGG - Intronic
1148078800 17:44955994-44956016 CTAAGGTTATGGGGACCAGAGGG - Intergenic
1148619719 17:49025496-49025518 CTATGGTGTTGGTGAGCAGAAGG + Intronic
1148823505 17:50375369-50375391 CTCTGGTGCTGGAGGACAGGAGG - Exonic
1150299078 17:64033649-64033671 CTATGGTGATGGAAGCCAGAGGG + Intergenic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1152999338 18:439472-439494 CTCTGCTTCTGGAGACCATAAGG - Intronic
1155438748 18:25839647-25839669 ATGAGGTGCTGGAGGCCAGAGGG + Intergenic
1157446266 18:47748833-47748855 CTGTGATCCTGGAGGCCAGAGGG - Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158543109 18:58374590-58374612 GGAGGCTGCTGGAGACCAGAGGG - Intronic
1159402157 18:67952796-67952818 CTTTGGCCCTGGACACCAGAAGG + Intergenic
1159582644 18:70250339-70250361 CCACGGTGCTGTAGACCAGACGG - Intergenic
1160131815 18:76231912-76231934 CTATGCTGCTGGAGTCGAAAGGG + Intergenic
1163115008 19:15183951-15183973 CTGAGGTGCTTGAGCCCAGAAGG + Intronic
1165010266 19:32840838-32840860 ACATGGTGCTGGAGTCCAGTGGG + Intronic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1167773891 19:51542488-51542510 CTCTGGTGCTGGAGAACAAGGGG - Intergenic
1168713100 19:58512850-58512872 CTATTGTGCTGAAGAGGAGAGGG + Intergenic
925754428 2:7120179-7120201 GCCTGGAGCTGGAGACCAGATGG + Intergenic
925955544 2:8960554-8960576 CTATGGTTGTGGAGATCAGCGGG - Intronic
926234562 2:11029530-11029552 CTCTGGTTCTGCAGAACAGAAGG - Intergenic
926752349 2:16208139-16208161 CTGTGATGCTAGAGACAAGATGG + Intergenic
932885658 2:75547024-75547046 TCATGGTTCTGGAGGCCAGAAGG - Intronic
935112797 2:100107540-100107562 CTATAGTGCTTGTGACCTGAGGG + Intronic
935807979 2:106767596-106767618 GTGTGGTGTTGGAGACCATAAGG - Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
942515372 2:176747242-176747264 GTGAGGTGCAGGAGACCAGAGGG - Intergenic
947829071 2:233126006-233126028 TTATGGGCCTGGTGACCAGAGGG + Intronic
948143178 2:235689364-235689386 GTATTGTGCTGGAGACCCTACGG - Intronic
948188535 2:236040874-236040896 CTGTGTAGCTGGAGACCACATGG + Intronic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
1169026544 20:2376300-2376322 GCATGGTGCTGGGGAGCAGATGG + Intergenic
1169213848 20:3782810-3782832 CCCTGGAGTTGGAGACCAGAAGG - Intergenic
1173749806 20:45468384-45468406 CTTTGCTGCTGGAGGCTAGAGGG - Intergenic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1174872447 20:54195691-54195713 GACAGGTGCTGGAGACCAGAGGG + Intergenic
1182074908 22:27488708-27488730 CTATGTGGCTTGAGACCAGTTGG + Intergenic
1183197296 22:36362261-36362283 CTATGGAGTAGGAGATCAGAGGG - Intronic
1183731147 22:39619262-39619284 GGATGGTGCTGGAGGCCAGCTGG - Intronic
1183803737 22:40190931-40190953 GTATAGTGCTGGAAACAAGAAGG + Intronic
1184487049 22:44786059-44786081 CCATGGTGCTGGACACTGGATGG + Intronic
1184816434 22:46875348-46875370 CTATGGTGATAGATACCAGAAGG + Intronic
949134953 3:553321-553343 CTTTGGTGCTGGTAAGCAGATGG + Intergenic
950703497 3:14766288-14766310 CTATTGTGCTGGTGCCCAGTTGG - Intronic
953201038 3:40778956-40778978 CTTTGGTTCTTTAGACCAGAGGG + Intergenic
953850701 3:46463853-46463875 ATTTGGAGCAGGAGACCAGAAGG + Intronic
955691072 3:61591278-61591300 TTATGGTACTGGATACCCGAGGG + Intronic
957616637 3:82537146-82537168 ATATGGTCCTGGAGAACAGCAGG - Intergenic
959306411 3:104671831-104671853 CTATGGTAATGGTGAGCAGATGG + Intergenic
961040046 3:123671816-123671838 CTTTGGTGGGGGAGACCAGATGG + Intronic
961833004 3:129634026-129634048 CTTTGGAGCTTGGGACCAGAGGG - Intergenic
962176785 3:133163505-133163527 CTATTGTGGTGGACAGCAGAGGG + Intronic
962944904 3:140158886-140158908 CTATTTTGCTGAAGATCAGATGG - Intronic
962984892 3:140526793-140526815 CTATTTTGCTGAAGATCAGATGG - Intronic
963733807 3:148996518-148996540 ATATGGTGATGGAGACCTGTAGG + Intronic
964951363 3:162298345-162298367 CTATGGAGCTGGGGAAGAGAAGG + Intergenic
965924222 3:173958159-173958181 CTATGTTGCGGGTGACAAGAAGG - Intronic
966744935 3:183266515-183266537 GTATGGTGGAGGAGGCCAGAGGG + Intronic
968105849 3:196000542-196000564 CCATGGAGCTGGAGACCCGGGGG - Intergenic
968623422 4:1614893-1614915 CTATGCTGACGGACACCAGATGG + Intergenic
968834770 4:2955267-2955289 CTGTGGTGCAGGTGACTAGAGGG - Intronic
968834810 4:2955433-2955455 CTGTGGTGCAGGTGACTAGAGGG - Intronic
968834823 4:2955489-2955511 CTGTGGTGCAGGTGACTAGAGGG - Intronic
969371163 4:6732554-6732576 CTAAAGTGCTGGTAACCAGAAGG + Intergenic
971117732 4:23667591-23667613 CTATAGTGTGGGAGACCTGAAGG - Intergenic
972928492 4:44041092-44041114 CCATGGTGGTGGTGCCCAGAGGG + Intergenic
983323848 4:166228005-166228027 CCATGTTGCTGGTGACGAGAAGG + Intergenic
985741314 5:1618952-1618974 CTGTGCAGCTGGAGACCTGACGG - Intergenic
987817634 5:22923587-22923609 CTTTGGTGCTGGAGATAAAAGGG - Intergenic
989705879 5:44329714-44329736 GTTTTGTGTTGGAGACCAGATGG - Intronic
992457965 5:76933498-76933520 ATATGCTGCTGAATACCAGAAGG + Intergenic
993777460 5:92017778-92017800 CCAAGGTGCTGGAAACCAGCTGG + Intergenic
994507348 5:100658850-100658872 CTATGGTACTGGAAACTAGGGGG + Intergenic
995363092 5:111321248-111321270 CAATGCTGCTGGACACAAGAAGG + Intronic
995444016 5:112222859-112222881 CTTTGGAGCAGGAGTCCAGAAGG - Intronic
997431700 5:133845350-133845372 CTATGGTCCTTGAGGCCTGAGGG + Intergenic
997479355 5:134172263-134172285 CTTTGGTGCTGGTGAAAAGAAGG - Intronic
998651683 5:144127704-144127726 CCATGGTGCTGGTGACCTCAAGG + Intergenic
1001695017 5:173663595-173663617 CCATGGTGCTGGATCCCTGAGGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002660655 5:180789224-180789246 CTTTGGAGCTCGACACCAGATGG - Intergenic
1003495974 6:6663524-6663546 CCATCGTGGTGGAGACCAGCTGG + Intergenic
1004478412 6:15996127-15996149 TCATGGGCCTGGAGACCAGAAGG + Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1007302097 6:40875268-40875290 ATCTGGTCCTGGAGACCAGTGGG - Intergenic
1007445441 6:41902040-41902062 GTATGGGGTTGGAGACCACAAGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1014505236 6:122247371-122247393 CCATGCTGCAGGAGACAAGAAGG - Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023562614 7:41491526-41491548 TTGTGGTGCTGGTGACCTGAGGG + Intergenic
1023746692 7:43328931-43328953 CTATTGTGCTGGAGGCCTGCTGG + Intronic
1024346947 7:48322882-48322904 CTATAGTGATAGAGAACAGATGG - Intronic
1024715433 7:52074645-52074667 CTGTGGCACAGGAGACCAGAAGG + Intergenic
1025144184 7:56490684-56490706 TTTAGGTGCTGGAGCCCAGAGGG - Intergenic
1026129792 7:67610691-67610713 CATGGGTTCTGGAGACCAGAGGG + Intergenic
1027248904 7:76386431-76386453 CGAATGTGCTGGAGACCATAAGG + Intergenic
1029159719 7:98543047-98543069 TCACGGTTCTGGAGACCAGAAGG + Intergenic
1030571325 7:111228506-111228528 TGATGGTCCTTGAGACCAGATGG + Intronic
1032457954 7:132087845-132087867 CCATGCTGCTGGAGATCAGGAGG - Intergenic
1032501739 7:132404831-132404853 CTGTGGCCCAGGAGACCAGAAGG + Intronic
1032529106 7:132605435-132605457 CTTTGGTCCTGGAGAACAGGTGG + Intronic
1034268489 7:149792295-149792317 CTAGGCTGCTGGTGCCCAGAAGG + Intergenic
1034404751 7:150896028-150896050 TCATGGTTCTGGAGGCCAGAAGG - Intergenic
1035022802 7:155809080-155809102 CTAAGGGGCAGGAGGCCAGAGGG - Intronic
1035701087 8:1639630-1639652 CTGTGCTGCTGGAGACCATAGGG - Intronic
1038507806 8:28100881-28100903 ATTTGGTGCTGGGGACCATATGG - Intronic
1039647747 8:39305829-39305851 CTACAGTGCTGGAGGCCTGAGGG + Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039924494 8:41916599-41916621 CTACGGTGACGGAGAGCAGAAGG - Intergenic
1045326074 8:101118780-101118802 CCTTGGAGCTGGAGCCCAGAGGG + Intergenic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1046820979 8:118634087-118634109 CTATGTTGCTGTAAACCTGAAGG + Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049422061 8:142521394-142521416 GGATGGGGCTGGAGACCACAGGG - Intronic
1049480701 8:142821108-142821130 GTAGGGTGCAGGAGCCCAGAGGG + Intergenic
1049709150 8:144055932-144055954 GGATGGTGCTGGGGAGCAGAGGG + Exonic
1050051592 9:1607796-1607818 TTTGGGTGCTGGAGACCTGAAGG - Intergenic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055371566 9:75605099-75605121 CTTTGGGGTTTGAGACCAGATGG + Intergenic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1057261647 9:93587865-93587887 CCATGCTGCTGGAGAACGGACGG - Intronic
1060937008 9:127521782-127521804 CTAAGGTGCAGTGGACCAGAGGG - Intronic
1061955947 9:133961430-133961452 ATCTGGGGCTGCAGACCAGAGGG + Intronic
1187309992 X:18132787-18132809 CTGTGGTGAGGGACACCAGAAGG + Intergenic
1187691965 X:21877641-21877663 CTGTGGTGCTGGTAAACAGAGGG - Intronic
1196481629 X:116156943-116156965 GTAAGCTACTGGAGACCAGAGGG + Intergenic