ID: 1088914122

View in Genome Browser
Species Human (GRCh38)
Location 11:114214168-114214190
Sequence GGCACTGTCCCCTTACTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088914122_1088914126 -1 Left 1088914122 11:114214168-114214190 CCCCATAGTAAGGGGACAGTGCC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1088914126 11:114214190-114214212 CTTACTCATCTTTCCATCTCTGG 0: 1
1: 0
2: 5
3: 33
4: 339
1088914122_1088914127 0 Left 1088914122 11:114214168-114214190 CCCCATAGTAAGGGGACAGTGCC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1088914127 11:114214191-114214213 TTACTCATCTTTCCATCTCTGGG 0: 1
1: 0
2: 1
3: 32
4: 402
1088914122_1088914130 13 Left 1088914122 11:114214168-114214190 CCCCATAGTAAGGGGACAGTGCC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1088914130 11:114214204-114214226 CATCTCTGGGACCTAACTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 133
1088914122_1088914129 12 Left 1088914122 11:114214168-114214190 CCCCATAGTAAGGGGACAGTGCC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1088914129 11:114214203-114214225 CCATCTCTGGGACCTAACTCAGG 0: 1
1: 0
2: 0
3: 12
4: 192
1088914122_1088914131 18 Left 1088914122 11:114214168-114214190 CCCCATAGTAAGGGGACAGTGCC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1088914131 11:114214209-114214231 CTGGGACCTAACTCAGGGCCTGG 0: 1
1: 0
2: 3
3: 26
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088914122 Original CRISPR GGCACTGTCCCCTTACTATG GGG (reversed) Intronic
900708554 1:4095899-4095921 GGCACAGTCCCATTCCTCTGAGG - Intergenic
900742292 1:4338118-4338140 GGCACTGTCCCTTTAGTAAAAGG - Intergenic
900775865 1:4585172-4585194 GGCATTGTCTCCTTCCCATGTGG + Intergenic
901773373 1:11542641-11542663 GGCTCTGTCCCCGCACTAGGGGG + Intergenic
902411726 1:16215844-16215866 TGCAGTGTCTCCTCACTATGTGG - Intergenic
905092283 1:35439131-35439153 GTCACTCACCCCTTACTCTGTGG + Intronic
905106254 1:35565333-35565355 AGCCCTGTCCCCTGAGTATGAGG + Exonic
911363289 1:96906159-96906181 TGCCCTGTCCTCTTACTTTGGGG - Intergenic
911889123 1:103344722-103344744 GGGACTGATCCCTTAATATGTGG - Intergenic
917099221 1:171428967-171428989 GGCACTGACCCCTTAACCTGTGG + Intergenic
917967645 1:180188437-180188459 GGCACTGTCGCCTTAGAAGGCGG + Intronic
1067124936 10:43507846-43507868 GTCACTGTCCCATCACCATGTGG - Intergenic
1072690268 10:97568135-97568157 GGCCCTGCCCACTTACCATGAGG - Exonic
1074559419 10:114521860-114521882 GGCACTGTTCCCCGACTATCTGG - Intronic
1075880790 10:125849003-125849025 GGCATAGTCCCCTCAATATGGGG + Intronic
1076636233 10:131883995-131884017 GGCACTGGCCACTTGCTCTGGGG + Intergenic
1077268528 11:1664481-1664503 GGAACTGTGCACTTACCATGGGG + Intergenic
1077272351 11:1687137-1687159 GGAACTGTGCACTTACCATGGGG - Intergenic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084225478 11:67712238-67712260 TGCATTGTCCCCTTACAGTGTGG - Intergenic
1084263301 11:67992088-67992110 TGCATTGTCCCCTTACAGTGTGG - Intronic
1088724384 11:112621295-112621317 GTCTCTGTTCCCTAACTATGAGG - Intergenic
1088914122 11:114214168-114214190 GGCACTGTCCCCTTACTATGGGG - Intronic
1088992890 11:114970011-114970033 GGCACAGTCCCATAACTAGGTGG - Intergenic
1096244205 12:49975282-49975304 GGCAAGGTCCCCTTACCTTGTGG + Intronic
1096976120 12:55700039-55700061 GGCTCTGTCTCCCTACTCTGTGG - Intronic
1101366906 12:104080766-104080788 GGCACTGTCCCTTTAGTTTCTGG - Exonic
1101637797 12:106560549-106560571 GACACTGTCCCTATACTCTGGGG - Intronic
1105852928 13:24351647-24351669 GGCTCTGGCCCATTATTATGGGG - Intergenic
1108532924 13:51344358-51344380 GCCACTGTCCCCCTGCTTTGTGG + Exonic
1114484412 14:23054490-23054512 AGCAATGGCCCCTTACTCTGTGG + Exonic
1117832541 14:59766924-59766946 GGCACTGAGCACCTACTATGTGG + Intronic
1130974997 15:88767319-88767341 GGTACTGTGCCCTTAACATGTGG - Intergenic
1134804706 16:17114371-17114393 GGCACTGAGCCCTCACTCTGTGG + Intronic
1140825186 16:78699895-78699917 GGCATTGTCCCGTCCCTATGAGG + Intronic
1145296670 17:21598413-21598435 GCCACTGTCCCCTCACTCTGTGG + Intergenic
1145367109 17:22273665-22273687 GCCACTGTCCCCTCACTTTGTGG - Intergenic
1147567554 17:41547107-41547129 GGCACTGTCCTCTTCCTATATGG + Intergenic
1152613697 17:81328475-81328497 GGCACTGTGTCCTCCCTATGGGG - Intronic
1161992909 19:7695140-7695162 GTCACTGTACCCTTAATGTGGGG - Intronic
1165793238 19:38504804-38504826 GGCTCTGCCCCCCGACTATGTGG + Exonic
925148978 2:1601640-1601662 GGCTTTGTCCGCTGACTATGGGG + Intergenic
926308730 2:11659253-11659275 AGCAGTGTCACCTTACCATGAGG - Intronic
926455448 2:13061888-13061910 GGAACTGTCTCCTTACTAGTAGG + Intergenic
928158467 2:28898058-28898080 GGCTCAGTCACTTTACTATGTGG - Intronic
928930154 2:36616008-36616030 GACACTTTCCCCTTACAATTTGG - Intronic
930132883 2:47870473-47870495 GGCACTTTCCTCTTTTTATGAGG - Intronic
932180181 2:69639929-69639951 GGCTCTGTCCCCTAACAATGGGG + Intronic
932276850 2:70458183-70458205 GGCACTGGCCCTTTCCTATGAGG + Intronic
936634251 2:114237008-114237030 GACACTGTCCCTATGCTATGGGG - Intergenic
937312044 2:120908584-120908606 GGCAGTTTCCCCTTCCTAGGAGG + Intronic
942759622 2:179383011-179383033 GGCACTATCCCATTTGTATGGGG + Intergenic
945319763 2:208407361-208407383 GGAAATATCCCCTTACTTTGCGG - Intronic
1172467378 20:35166315-35166337 GGCACTTCCCCCTTAGGATGAGG - Intergenic
1173639958 20:44594686-44594708 GGCTCTGTCTCCTTGCAATGGGG + Intronic
1177080359 21:16631895-16631917 GGTACTTCCCCCTTTCTATGAGG + Intergenic
1179559707 21:42207638-42207660 GGCACTGCCACCTTACTACCAGG + Intronic
1182036949 22:27206333-27206355 GACCCTCTCCCCTTACTGTGGGG - Intergenic
1184549199 22:45195489-45195511 GGCTCTGTCCCCACACTTTGGGG + Intronic
950892123 3:16413435-16413457 GGCATTGCCACCTTCCTATGGGG + Intronic
954719185 3:52545588-52545610 GCCACTCTCCCCTTCCTATGAGG - Intronic
955692428 3:61603852-61603874 GTCTCTCTCCCCTTACTATAAGG + Intronic
957136111 3:76291384-76291406 GGCAATGTCCCCTTTTTATTTGG + Intronic
964618951 3:158701256-158701278 GGCACTGTCCTCATAGTATTGGG + Intronic
966135487 3:176693561-176693583 GGCACTGTGCCCTAACCATCTGG + Intergenic
976096074 4:81509628-81509650 GCAACTGTCCCCTCTCTATGAGG - Intronic
989404368 5:41043690-41043712 GTCCATGTCTCCTTACTATGGGG + Intronic
992425061 5:76648335-76648357 GGCACTGCCTCATTACTAGGAGG - Intronic
996239097 5:121171999-121172021 GGCACTGTGCCCTTTCTCTAGGG - Intergenic
1003890978 6:10563395-10563417 GGAACAGTCCCCTTCTTATGGGG - Intronic
1009752008 6:67886751-67886773 TGCCCAGTCCCCTTATTATGCGG - Intergenic
1016266874 6:142242943-142242965 CCCAGTGTCCCCTTACAATGTGG + Intergenic
1023889271 7:44381043-44381065 TGCACTGACCCCATGCTATGAGG - Exonic
1024443695 7:49452735-49452757 TGCACTTTCCCTTTACTCTGTGG - Intergenic
1041093428 8:54326083-54326105 GGCACTTTCCCATTGCTTTGAGG - Intergenic
1041616892 8:59917475-59917497 GTCAATGTACCCTTCCTATGAGG - Intergenic
1047796395 8:128260286-128260308 GGCCCCGTCCTCTTTCTATGTGG - Intergenic
1049558929 8:143297735-143297757 GGGACTGACCCCTTACCCTGTGG + Exonic
1053608729 9:39687665-39687687 GAGACTGTGCCCTTACTGTGTGG + Intergenic
1053866575 9:42444017-42444039 GAGACTGTGCCCTTACTGTGTGG + Intergenic
1054244795 9:62654733-62654755 GAGACTGTGCCCTTACTGTGTGG - Intergenic
1054558922 9:66689276-66689298 GAGACTGTGCCCTTACTGTGTGG - Intergenic
1055531127 9:77185109-77185131 GGAACTGAGCCCTTACCATGTGG + Intronic
1187527454 X:20066895-20066917 GCCACTGTCCCCTTACATGGTGG + Intronic
1197980256 X:132210847-132210869 TGCACTTCCCCCTTACTATTAGG + Intronic
1198103061 X:133438548-133438570 GGCACTGTCCCCTTGGAGTGTGG + Intergenic