ID: 1088916198

View in Genome Browser
Species Human (GRCh38)
Location 11:114229776-114229798
Sequence TACCAGGACCTAACACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088916198 Original CRISPR TACCAGGACCTAACACAGAC TGG Intronic
904503156 1:30929358-30929380 CACTAGGCCCTAACACACACAGG - Intergenic
905837152 1:41135613-41135635 TATAAGGACATAACAGAGACTGG - Intronic
907094172 1:51760761-51760783 TACCTGGAGGTAACACAGTCTGG - Exonic
909213195 1:72850492-72850514 TAGCAGAACCTAACTCAGCCTGG - Intergenic
916799469 1:168202996-168203018 CACCAGGACTTAAGAAAGACTGG + Intergenic
918034997 1:180860657-180860679 TACCAGAAGAGAACACAGACTGG + Intronic
918320001 1:183355229-183355251 GAGGAGGACCTAACACAGATTGG - Intronic
921956306 1:220987078-220987100 CACTAGGACCCAACACAGATTGG - Intergenic
922853544 1:228755163-228755185 TACCTGGACCTCCCTCAGACAGG - Intergenic
924479497 1:244415253-244415275 AACCAGGACATAACATATACTGG + Intronic
1065403609 10:25336010-25336032 TACCAGGTGCTTACACACACAGG - Intronic
1065865230 10:29909217-29909239 CACCAGCAGGTAACACAGACTGG - Intergenic
1068230343 10:54163246-54163268 TATAAGGAACTAACTCAGACTGG + Intronic
1069336879 10:67362293-67362315 TACCAAAACCTGACAAAGACAGG + Intronic
1076164198 10:128268734-128268756 TACCAGGACCAAATGCAGGCAGG + Intergenic
1076249529 10:128974508-128974530 TTCCAGGACCTAACAGATTCAGG - Intergenic
1079782415 11:24624287-24624309 TACCAGCACCAAATACACACAGG - Intronic
1085558440 11:77447341-77447363 TACCAGCACCTAACAAAAATAGG + Intronic
1087025552 11:93645942-93645964 TTCCAAAACTTAACACAGACAGG - Intergenic
1088916198 11:114229776-114229798 TACCAGGACCTAACACAGACTGG + Intronic
1093275930 12:17126695-17126717 TACAACAAACTAACACAGACAGG + Intergenic
1093895994 12:24574853-24574875 TACGAGGAACTAACTGAGACTGG + Intergenic
1094227176 12:28058713-28058735 TACCAAGAGTTAACACAGAGTGG - Intergenic
1099069690 12:78030363-78030385 TGCCAGGTCCTAGCTCAGACTGG + Intronic
1101941645 12:109103685-109103707 TTCCAGGACCAAACACAGCAGGG - Intronic
1110355232 13:74559752-74559774 TGCCAGGAGCTATCAAAGACTGG + Intergenic
1114790872 14:25656888-25656910 TCCCAGGCCCTACAACAGACTGG - Intergenic
1114831398 14:26146411-26146433 TACCAGGAACACACACATACAGG - Intergenic
1114897332 14:27007910-27007932 TTCCAGTATGTAACACAGACAGG - Intergenic
1115105597 14:29757894-29757916 TACCAGGAAATGACAGAGACAGG + Intronic
1117092365 14:52264042-52264064 TCCCAGGACCTAACACATCATGG + Intergenic
1117464015 14:55974434-55974456 CACCAGAGCCTAACACACACAGG - Intergenic
1118785175 14:69039713-69039735 TCCCAGCACCCAACACTGACTGG + Intergenic
1120306084 14:82772351-82772373 TACCAGAATCTAACACAGCTAGG - Intergenic
1120392462 14:83925490-83925512 TATCAAGACCTAACTGAGACTGG - Intergenic
1120562353 14:86010896-86010918 TTTTACGACCTAACACAGACAGG - Intergenic
1124578112 15:30927278-30927300 CACCAGGACGGAACACTGACTGG + Intronic
1125119058 15:36131426-36131448 TACCAGGACCTAACTGATAGTGG - Intergenic
1125758346 15:42081131-42081153 TACCTGGACCACACACAGACAGG + Exonic
1141428761 16:83960245-83960267 TAACAGCAGATAACACAGACGGG - Intronic
1146124357 17:30220171-30220193 TCCCGTGACCTAACACAGAGTGG - Intronic
1146280282 17:31540230-31540252 TACCAGCACCTAACAGATGCGGG + Intergenic
1152475322 17:80514060-80514082 CACCAGGATGTAACACACACAGG + Intergenic
1156032009 18:32723553-32723575 TACCAGAACCAGACACAGAGAGG - Intronic
1157270953 18:46275753-46275775 TACCAGGACCCAAAACACATTGG - Intergenic
1159641635 18:70869990-70870012 TTCCAGGACCTCCCACAGATAGG + Intergenic
1167914473 19:52729041-52729063 TACCATGACAAAACACTGACAGG + Intronic
1168008010 19:53506823-53506845 TACCTGCACCCAACCCAGACTGG - Intergenic
1168165389 19:54543585-54543607 CACCAGGCCCTCTCACAGACAGG + Exonic
925022680 2:584076-584098 AAGCCTGACCTAACACAGACGGG - Intergenic
925194646 2:1913303-1913325 TACTAGGACCTACCACATCCAGG - Intronic
925553880 2:5106947-5106969 TGCAAGGGCCTATCACAGACTGG - Intergenic
927598435 2:24418783-24418805 TACCAGGAGCTAGGACAGAAAGG + Intergenic
930604324 2:53477070-53477092 GACCAGGACATAACACAAATAGG + Intergenic
931184909 2:59940476-59940498 TACAAGGGCCTAAAACAGAAAGG + Intergenic
934030238 2:88038597-88038619 TACAAAGACATAACAAAGACTGG + Intronic
939267889 2:139897975-139897997 TACCACTCCCAAACACAGACAGG - Intergenic
941762921 2:169264732-169264754 CACCAGGTCCTAACAAAGGCAGG + Intronic
944116707 2:196195165-196195187 AACCAGGAATTAACACAGAATGG - Exonic
944739301 2:202595917-202595939 TACCAGCACCTAACATTGCCTGG - Intergenic
947635344 2:231677903-231677925 TCCCAGGACCTGGCACAAACGGG - Intergenic
1172345007 20:34191254-34191276 TATCAGGAGCTTACACATACTGG + Intergenic
1173211040 20:41031644-41031666 TAACAGGACCTAACTCACAAGGG - Intronic
1174338726 20:49882962-49882984 CACCAGGACCTTCCCCAGACAGG - Intronic
1175894886 20:62331597-62331619 TCCCAGGACCTGACCCAGGCAGG + Intronic
1178661838 21:34513407-34513429 GACCATAACCTACCACAGACAGG + Intronic
1179647684 21:42785253-42785275 TACCTGGACCCCAGACAGACAGG + Intergenic
1182120708 22:27784707-27784729 TAGCAGGGCCTATTACAGACAGG - Intronic
1183427764 22:37748618-37748640 TGCCAGGACCCAGCACAGATAGG - Intronic
1183469294 22:37997133-37997155 TGCCAGGAACAAACACAGAGGGG + Intronic
1183957997 22:41393939-41393961 TACCAGCCCCTAAGCCAGACTGG - Intronic
1184027314 22:41867395-41867417 TACCAGAACCTCATTCAGACAGG - Intronic
949477904 3:4466429-4466451 TCCCGGCACCTAACACATACAGG + Intronic
950424156 3:12915574-12915596 TACCAGGGCCCATCACATACCGG + Exonic
950880728 3:16321030-16321052 CTCCGGGACCTAACACAGATGGG + Intronic
951883832 3:27504893-27504915 TTCCAGGAACTAAAACAAACTGG + Intergenic
952694199 3:36246988-36247010 TACCAGGCCTGAAGACAGACAGG + Intergenic
952847849 3:37703101-37703123 TAACCAGACCTAAAACAGACAGG + Intronic
956044038 3:65176186-65176208 TCCCAGTACCTACCACAGGCTGG - Intergenic
960960042 3:123064379-123064401 TTCCAGGACCTAGCACAGGACGG - Intergenic
969335007 4:6502604-6502626 TGCCAGGACCTAGCACAGGTTGG - Intronic
971652558 4:29297169-29297191 TCCTAGAACATAACACAGACAGG - Intergenic
973032728 4:45364078-45364100 CACCAGGAGCTAACATAGACAGG + Intergenic
984496575 4:180505512-180505534 TACTAGTAACTAACATAGACTGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
986463004 5:7992688-7992710 TACCATAACATACCACAGACTGG + Intergenic
986565320 5:9107825-9107847 TACCAGGTCCTCTCACACACTGG - Intronic
986671153 5:10144158-10144180 TACCAGGAGCTACCAGAAACTGG - Intergenic
988017618 5:25579457-25579479 TACCAGCTCTTCACACAGACTGG - Intergenic
988122069 5:26977522-26977544 AACCAGGAGCAAACAAAGACTGG + Intronic
988323717 5:29734914-29734936 TACCAGGACCTACCAGAAAGTGG + Intergenic
990026874 5:51203007-51203029 TTTCAGTACCTTACACAGACTGG + Intergenic
991958589 5:72019931-72019953 TCCCATGACCTAGAACAGACTGG + Intergenic
993188007 5:84645399-84645421 TGCCAGACCCTCACACAGACTGG - Intergenic
994095236 5:95841934-95841956 TAGCAGGGCCTAAAAAAGACGGG - Intergenic
1001389838 5:171369920-171369942 TCCCTAGACCTCACACAGACAGG + Intergenic
1003143534 6:3491349-3491371 TGCCAGGAGCTACCACAAACTGG - Intergenic
1004687067 6:17956805-17956827 AAGAAGGAACTAACACAGACAGG + Intronic
1006398294 6:33801300-33801322 TACCAGGCCCAAATCCAGACAGG - Intronic
1008967321 6:57326095-57326117 TACCAGCACTTAAGACAGAAGGG - Intronic
1018995641 6:168708103-168708125 TAACTGGACGTAAAACAGACAGG + Intergenic
1019542556 7:1558133-1558155 GACCAGCAGCAAACACAGACAGG - Intronic
1023495356 7:40789268-40789290 TACCAGGACCTAAGAGGGAGGGG - Intronic
1026635409 7:72077682-72077704 AACCAGGATCTCACACAGATAGG + Intronic
1028949984 7:96623884-96623906 TGCCAGGAGCTAACACAAGCTGG - Intronic
1032409039 7:131679986-131680008 TGCGAGCACCTAACAGAGACAGG + Intergenic
1033686417 7:143645001-143645023 TAGCAGGACCTAAGCCAGTCTGG + Intronic
1033689320 7:143722314-143722336 TAGCAGGACCTAAGCCAGTCTGG - Intronic
1033698195 7:143812620-143812642 TAGCAGGACCTAAGCCAGTCTGG - Intergenic
1036494762 8:9260180-9260202 TACCAGGAGATAACACTGAAGGG - Intergenic
1036692635 8:10953542-10953564 AAGAATGACCTAACACAGACGGG + Intronic
1037949207 8:23007801-23007823 CACCAGGAGCTGAGACAGACAGG - Intronic
1038507975 8:28102301-28102323 TACCATGAACTAACATGGACAGG - Intronic
1042800462 8:72712514-72712536 TAACAGGAGCTATCACTGACTGG + Intronic
1043587229 8:81783496-81783518 TCCCAAGACCTCACACAGAGAGG + Intergenic
1043588135 8:81793676-81793698 CACCAGGGCCTATCACACACTGG - Intergenic
1043821222 8:84867796-84867818 AATCAGCACCTAACACAGACAGG + Intronic
1051692553 9:19731838-19731860 TAGCAGGACCTCACACATACTGG + Intronic
1052983043 9:34462850-34462872 GAACAGTACCTAACACAGAGTGG - Intronic
1059829810 9:118082773-118082795 CACCAGGACCTAAGACAAATGGG - Intergenic
1060367414 9:123032199-123032221 TACCAACACCTAGCACAGAGGGG - Intronic
1187041932 X:15605580-15605602 TACCAGGACCTGACCATGACTGG - Intergenic
1187470407 X:19564757-19564779 TTCCTGTTCCTAACACAGACTGG + Intronic
1193310838 X:80008621-80008643 AACCAGGACCTACCAGAGAATGG - Intergenic
1202245444 Y:22815549-22815571 TAACAGGGCCTAGCACAGAGAGG + Intergenic
1202398433 Y:24449297-24449319 TAACAGGGCCTAGCACAGAGAGG + Intergenic
1202472348 Y:25220789-25220811 TAACAGGGCCTAGCACAGAGAGG - Intergenic