ID: 1088919031

View in Genome Browser
Species Human (GRCh38)
Location 11:114248372-114248394
Sequence CCACCTTAGTTGCTTAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088919031 Original CRISPR CCACCTTAGTTGCTTAAAAT TGG Intronic
901683106 1:10927296-10927318 CCACATGAGCAGCTTAAAATTGG - Intergenic
902029573 1:13411980-13412002 CCACCTTAGTGGCTTTTAATTGG + Intronic
904349878 1:29898332-29898354 CCACCATGGGCGCTTAAAATGGG - Intergenic
906445366 1:45892061-45892083 CAACCATAGTTCCTTAAAAGTGG + Intronic
907731024 1:57065816-57065838 CCCCCTTAGATGCTCACAATGGG - Intronic
911873125 1:103125457-103125479 CCTCCTTTGTTGCTGAAAAGTGG + Intergenic
918035066 1:180861848-180861870 TCATCTTAGTAGCTTGAAATTGG - Intronic
919293198 1:195660408-195660430 CCACCTAAGTTATTTAAAGTGGG - Intergenic
919610013 1:199733595-199733617 CCACATTAGTCACTCAAAATTGG - Intergenic
921059080 1:211567316-211567338 CAACTTTAGTGGCTTAAAACAGG + Intergenic
924711294 1:246532038-246532060 CCAGCTTAGTTTTTTATAATAGG + Intergenic
1064451724 10:15447983-15448005 CCACCATTTTTGTTTAAAATTGG - Intergenic
1064678865 10:17789057-17789079 CCACCTTGGTAGCTTGAAATCGG - Intronic
1065105793 10:22383158-22383180 CCAACTTAGATGCTCAAAAAAGG - Intronic
1067033366 10:42895860-42895882 TTACCTTAGTGGCTTGAAATTGG - Intergenic
1067486989 10:46659920-46659942 CCCCCTTAGTTGCCAAACATGGG - Intergenic
1067607815 10:47682053-47682075 CCCCCTTAGTTGCCAAACATGGG + Intergenic
1068782465 10:60935890-60935912 CCACATCAGTAGCTTGAAATTGG + Intronic
1069898407 10:71693214-71693236 CCAAGTTGGTAGCTTAAAATGGG + Intronic
1071818641 10:89257510-89257532 CCAACTTAGCTGTTTAAAGTAGG - Intronic
1074569714 10:114613381-114613403 CCACCTTGGTAGCTTGAAATTGG + Intronic
1075259843 10:120953727-120953749 TCACATTAGTAGCTTAAGATTGG + Intergenic
1076982823 11:214021-214043 CCAATTTAGATGTTTAAAATAGG + Intronic
1077875201 11:6298884-6298906 CAACCTTAGTTTCCTAAAAGGGG - Intergenic
1079908294 11:26276942-26276964 TCACCTTAGTTGCTTAAATGTGG + Intergenic
1082756415 11:57080853-57080875 AAAATTTAGTTGCTTAAAATAGG - Intergenic
1083914071 11:65728555-65728577 CCAACTTAGTGGCTAAAGATAGG + Intergenic
1088919031 11:114248372-114248394 CCACCTTAGTTGCTTAAAATTGG + Intronic
1093097553 12:14989322-14989344 GCACACTAGTTGCTTATAATCGG - Intergenic
1099246135 12:80195788-80195810 TCACATTAGTAGCTTAAAATTGG + Intergenic
1099403614 12:82231368-82231390 CATCATTAGATGCTTAAAATAGG - Intronic
1104204553 12:126625705-126625727 CCACGTTACTAGCTTGAAATTGG + Intergenic
1108460288 13:50659745-50659767 TCACTTTAGTAGCTTTAAATTGG + Intronic
1110221957 13:73083394-73083416 CTGCATTAGATGCTTAAAATAGG - Intergenic
1112916847 13:104561775-104561797 CCAGTGTACTTGCTTAAAATGGG + Intergenic
1113031086 13:105994436-105994458 CCACCTGAGTTGCTCCAGATGGG - Intergenic
1113271849 13:108683240-108683262 ACATCTGAGTTGCTTAAAGTGGG - Intronic
1114292821 14:21302725-21302747 CCAACTTCATTGCTTAAAAGTGG + Intronic
1116127372 14:40805503-40805525 CCTACTTACTTGCTTTAAATTGG - Intergenic
1125776027 15:42214757-42214779 CAACCTAAGTTTCTTGAAATTGG + Intronic
1127198133 15:56612880-56612902 CAAATTTAGTGGCTTAAAATAGG + Intergenic
1127489983 15:59453481-59453503 CCACCTTAGTTGGTTGAGTTGGG - Intronic
1131654674 15:94443731-94443753 CCACCCCATTTGCTTCAAATGGG - Intronic
1147483861 17:40793774-40793796 CCACATTTGTAGCTTAAAAGAGG + Intronic
1149004414 17:51790060-51790082 CCTCCTTGGTTGCTGGAAATGGG + Intronic
1151693019 17:75698745-75698767 TCACCTTGGTAGCTTGAAATTGG + Intronic
1156678788 18:39564490-39564512 CCTCCTAAGTTTTTTAAAATTGG + Intergenic
1157922692 18:51730019-51730041 TCACATTGGTAGCTTAAAATTGG + Intergenic
1158043917 18:53132290-53132312 CCAAGTTAGTAGCTTGAAATTGG - Intronic
1158813038 18:61059371-61059393 CCACCTTAGACGCTTACAGTTGG - Intergenic
1160561108 18:79756175-79756197 CCACATTGATAGCTTAAAATGGG + Exonic
929380675 2:41348483-41348505 TCACATTAGTAGCTTAAAATGGG + Intergenic
932546149 2:72712463-72712485 CAACCTTAATAGCTTAAAAGAGG - Intronic
938149446 2:128869294-128869316 TCACTTTGGTAGCTTAAAATTGG - Intergenic
938542082 2:132291672-132291694 TCACCTTAGTTGTTTCAGATCGG + Intergenic
942561429 2:177224059-177224081 CAACCCTTGTTGCCTAAAATAGG + Intergenic
943180989 2:184540783-184540805 TCACCTGAGTTTCTTACAATGGG - Intergenic
943434448 2:187847266-187847288 CAATTTTATTTGCTTAAAATGGG - Intergenic
945182808 2:207109171-207109193 CCAGCTTTCTTTCTTAAAATAGG + Intronic
948040706 2:234899437-234899459 CCACCTGAGTGGCTTCAACTAGG - Intergenic
1169385547 20:5146121-5146143 CCAGCTCAGTTTCTCAAAATTGG - Intronic
1170410143 20:16081138-16081160 CTACCTTAGTGGCTTTTAATTGG + Intergenic
1171870965 20:30524546-30524568 TCACCTTAGTTGTTTCAGATCGG + Intergenic
1172935605 20:38617850-38617872 ACACCTAAGGTGCTTAGAATAGG - Intronic
1177001833 21:15622611-15622633 CACCTTTAGTTGCATAAAATTGG - Intergenic
1182857013 22:33526945-33526967 CCACGGGAGTTGCTTAAAAATGG + Intronic
1184196370 22:42931851-42931873 CCACCTGTGTTCCTTACAATTGG - Intronic
1184367413 22:44061126-44061148 CCAACTTTGCTGTTTAAAATGGG - Intronic
958812729 3:98880428-98880450 CCACCTTTCTTGCTTAAGAAAGG + Intronic
960521827 3:118663846-118663868 TCAGGTTAGTTGCTTGAAATTGG - Intergenic
966766652 3:183469212-183469234 CCACGCCCGTTGCTTAAAATTGG + Intergenic
974693936 4:65340100-65340122 CCATGTTAGTAGCTTACAATTGG - Intronic
982830349 4:160052039-160052061 CTACCTTCCTTGATTAAAATTGG + Intergenic
983261075 4:165457243-165457265 ACACATTAGTAGCTTCAAATTGG + Intronic
983426623 4:167592328-167592350 CCACATAGGTAGCTTAAAATTGG - Intergenic
989179970 5:38566933-38566955 TCACCTTGGTAGCTTAAAGTTGG - Intronic
989214514 5:38891045-38891067 CCACCTTAGTGGATTTTAATTGG + Intronic
993851187 5:93011557-93011579 AAACCTTAGTAGTTTAAAATTGG - Intergenic
996625139 5:125562046-125562068 CCACATGAGGTGCTTAAGATAGG + Intergenic
1000583492 5:163064407-163064429 CAAGCTTAGTTCCTTAAAACTGG - Intergenic
1007381536 6:41493194-41493216 CCACGTTAGTAGCTTGAAGTTGG + Intergenic
1009625416 6:66134328-66134350 CCAACTGTGTTGCTTCAAATTGG + Intergenic
1009975192 6:70664537-70664559 CTACGCTACTTGCTTAAAATAGG + Intergenic
1011293414 6:85801501-85801523 CCCCCTTACTTGCTTATGATTGG - Intergenic
1011727113 6:90220990-90221012 CAACTTTAGTTGCACAAAATTGG - Intronic
1013953434 6:115812698-115812720 CCATCCTATTTGCTTTAAATAGG + Intergenic
1014108456 6:117593213-117593235 CCACGTCAGTTGCTAAAAGTAGG - Intronic
1016276865 6:142363871-142363893 CCAAATGAGTTTCTTAAAATAGG + Intronic
1021298700 7:18942741-18942763 TCACGTTAGTAGCTTGAAATAGG + Intronic
1024483305 7:49888111-49888133 TCACATTAGTAGCTCAAAATTGG + Intronic
1027744558 7:82057184-82057206 TCACATTGGTAGCTTAAAATTGG + Intronic
1030933513 7:115555615-115555637 CCATATTGGTTGCTTGAAATTGG + Intergenic
1031592204 7:123607213-123607235 CCATCATAGTTCCTTAAAAGTGG + Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1039813708 8:41073230-41073252 CAACCTTAGTTCCATAAAACTGG - Intergenic
1044180942 8:89193475-89193497 CCAGTTTAGTCGCTTAAAATTGG - Intergenic
1048838605 8:138545300-138545322 CAAACTTAGAGGCTTAAAATAGG + Intergenic
1049935242 9:495426-495448 CCAACTTAGTTTCTTCAGATTGG + Intronic
1057592783 9:96388138-96388160 GCACCTTATTTGCTTATCATAGG - Exonic
1061233854 9:129330802-129330824 CAAACTTAGTGGCTTAAAATAGG + Intergenic
1186576611 X:10773196-10773218 CCACCTTAGTATCTGATAATAGG - Intronic
1186990674 X:15063781-15063803 TCACCTTGATTGTTTAAAATTGG + Intergenic
1189116519 X:38348811-38348833 TCACATTAGTAGCTTGAAATTGG + Intronic
1194426796 X:93748738-93748760 CCGCCTTAGCTCATTAAAATGGG - Intergenic
1195104984 X:101594605-101594627 CCACCCTAGCTGCTTCTAATTGG + Intergenic
1195158496 X:102147238-102147260 CAAACTTAGTGGCTTAAAATAGG + Intergenic
1195496134 X:105536502-105536524 TCACCTTCGTAGCTTGAAATTGG + Intronic
1195552701 X:106186420-106186442 CCACGCTAGTTGCTTTTAATTGG + Intronic
1197810221 X:130434615-130434637 CCAACTTCATTGCTTAAACTAGG - Intergenic
1199861832 X:151807967-151807989 CCAAGTTAGTAGCTTAAAATGGG - Intergenic
1201516029 Y:14819457-14819479 CTACCTTATCTGCTTTAAATTGG + Intronic